Transcript: Human XM_005269778.2

PREDICTED: Homo sapiens potassium calcium-activated channel subfamily M alpha 1 (KCNMA1), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNMA1 (3778)
Length:
12085
CDS:
99..3818

Additional Resources:

NCBI RefSeq record:
XM_005269778.2
NBCI Gene record:
KCNMA1 (3778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039050 CCCTGAAATCATAGAGTTAAT pLKO.1 1250 CDS 100% 13.200 9.240 N Kcnma1 n/a
2 TRCN0000000213 CCGAGCTGGAATTGGAAAGAA pLKO.1 1710 CDS 100% 5.625 3.938 N KCNMA1 n/a
3 TRCN0000000210 CCCAATAGAATCCTGCCAGAA pLKO.1 701 CDS 100% 4.050 2.835 N KCNMA1 n/a
4 TRCN0000000212 GTCAAGATAGAGTCAGCAGAT pLKO.1 1533 CDS 100% 4.050 2.835 N KCNMA1 n/a
5 TRCN0000000211 TGGCAGAAATACTACTTGGAA pLKO.1 1863 CDS 100% 3.000 2.100 N KCNMA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10934 pDONR223 100% 12.9% 11% None (many diffs) n/a
2 ccsbBroad304_10934 pLX_304 0% 12.9% 11% V5 (many diffs) n/a
3 TRCN0000467075 GAATTTCCCGCCGTAGCTTTTCAC pLX_317 48.6% 12.9% 11% V5 (many diffs) n/a
Download CSV