Transcript: Mouse XM_006518592.3

PREDICTED: Mus musculus potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (Kcnma1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnma1 (16531)
Length:
12375
CDS:
807..4775

Additional Resources:

NCBI RefSeq record:
XM_006518592.3
NBCI Gene record:
Kcnma1 (16531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518592.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039053 GCCCTCGTAATATACTTCATA pLKO.1 1377 CDS 100% 5.625 7.875 N Kcnma1 n/a
2 TRCN0000039050 CCCTGAAATCATAGAGTTAAT pLKO.1 1958 CDS 100% 13.200 10.560 N Kcnma1 n/a
3 TRCN0000000211 TGGCAGAAATACTACTTGGAA pLKO.1 2571 CDS 100% 3.000 2.400 N KCNMA1 n/a
4 TRCN0000202183 CATGGTGACTGTGGCTATGAT pLKO.1 12164 3UTR 100% 5.625 3.938 N A830039N20Rik n/a
5 TRCN0000039052 CCACCCAAAGATCAGGATCAT pLKO.1 2351 CDS 100% 4.950 3.465 N Kcnma1 n/a
6 TRCN0000191062 CGTGGTTTGTTTCTTTGTCTT pLKO.1 12125 3UTR 100% 4.950 3.465 N A830039N20Rik n/a
7 TRCN0000039049 GCAGGCTAATTCCCAAGGATT pLKO.1 3713 CDS 100% 4.950 3.465 N Kcnma1 n/a
8 TRCN0000039051 GCGACATACTTCAATGACAAT pLKO.1 4053 CDS 100% 4.950 3.465 N Kcnma1 n/a
9 TRCN0000000210 CCCAATAGAATCCTGCCAGAA pLKO.1 1409 CDS 100% 4.050 2.835 N KCNMA1 n/a
10 TRCN0000000212 GTCAAGATAGAGTCAGCAGAT pLKO.1 2241 CDS 100% 4.050 2.835 N KCNMA1 n/a
11 TRCN0000191806 GAGAAGAGAATAAATGCTGGT pLKO.1 12210 3UTR 100% 2.160 1.512 N A830039N20Rik n/a
12 TRCN0000192415 CCAATTCAGAGGTACCCATAT pLKO.1 12064 3UTR 100% 0.000 0.000 N A830039N20Rik n/a
13 TRCN0000015008 CCAACCAACCAACCAACCAAA pLKO.1 5941 3UTR 100% 4.950 2.475 Y HMBOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518592.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10934 pDONR223 100% 11.2% 10.1% None (many diffs) n/a
2 ccsbBroad304_10934 pLX_304 0% 11.2% 10.1% V5 (many diffs) n/a
3 TRCN0000467075 GAATTTCCCGCCGTAGCTTTTCAC pLX_317 48.6% 11.2% 10.1% V5 (many diffs) n/a
Download CSV