Construct: ORF TRCN0000467099
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009298.1_s317c1
- Derived from:
- ccsbBroadEn_07061
- DNA Barcode:
- TGGTAACCACAAGTGCTACCTGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TGM2 (7052)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467099
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7052 | TGM2 | transglutaminase 2 | NM_198951.3 | 99.9% | 100% | 936C>A |
2 | human | 7052 | TGM2 | transglutaminase 2 | NM_001323316.2 | 78.6% | 78.2% | (many diffs) |
3 | human | 7052 | TGM2 | transglutaminase 2 | NM_004613.4 | 78.6% | 78.2% | (many diffs) |
4 | human | 7052 | TGM2 | transglutaminase 2 | XM_011529028.1 | 78.6% | 78.2% | (many diffs) |
5 | human | 7052 | TGM2 | transglutaminase 2 | NM_001323318.2 | 69.6% | 69.1% | (many diffs) |
6 | human | 7052 | TGM2 | transglutaminase 2 | NM_001323317.2 | 66.9% | 66.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1710
- ORF length:
- 1644
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgaggagctg gtcttagaga ggtgtgatct ggagctggag accaatggcc 121 gagaccacca cacggccgac ctgtgccggg agaagctggt ggtgcgacgg ggccagccct 181 tctggctgac cctgcacttt gagggccgca actacgaggc cagtgtagac agtctcacct 241 tcagtgtcgt gaccggccca gcccctagcc aggaggccgg gaccaaggcc cgttttccac 301 taagagatgc tgtggaggag ggtgactgga cagccaccgt ggtggaccag caagactgca 361 ccctctcgct gcagctcacc accccggcca acgcccccat cggcctgtat cgcctcagcc 421 tggaggcctc cactggctac cagggatcca gctttgtgct gggccacttc attttgctct 481 tcaacgcctg gtgcccagcg gatgctgtgt acctggactc ggaagaggag cggcaggagt 541 atgtcctcac ccagcagggc tttatctacc agggctcggc caagttcatc aagaacatac 601 cttggaattt tgggcagttt gaagatggga tcctagacat ctgcctgatc cttctagatg 661 tcaaccccaa gttcctgaag aacgccggcc gtgactgctc ccgccgcagc agccccgtct 721 acgtgggccg ggtggtgagt ggcatggtca actgcaacga tgaccagggt gtgctgctgg 781 gacgctggga caacaactac ggggacggcg tcagccccat gtcctggatc ggcagcgtgg 841 acatcctgcg gcgctggaag aaccacggct gccagcgcgt caagtatggc cagtgctggg 901 tcttcgccgc cgtggcctgc acagtgctga ggtgcctggg catccctacc cgcgtcgtga 961 ccaactacaa ctcggcccat gaccagaaca gcaaccttct aatcgagtac ttccgcaatg 1021 agtttgggga gatccagggt gacaagagcg agatgatctg gaacttccac tgctgggtgg 1081 agtcgtggat gaccaggccg gacctgcagc cggggtacga gggctggcag gccctggacc 1141 caacgcccca ggagaagagc gaagggacgt actgctgtgg cccagttcca gttcgtgcca 1201 tcaaggaggg cgacctgagc accaagtacg atgcgccctt tgtctttgcg gaggtcaatg 1261 ccgacgtggt agactggatc cagcaggacg atgggtctgt gcacaaatcc atcaaccgtt 1321 cccTGATCGT TGGGCTGAAG ATCAGCACTA AGAGCGTGGG CCGAGACGAG CGGGAGGATA 1381 TCACCCACAC CTACAAATAC CCAGAGGGGT CCTCAGAGGA GAGGGAGGCC TTCACAAGGG 1441 CGAACCACCT GAACAAACTG GCCGAGAAGG AGGAGACAGG GATGGCCATG CGGATCCGTG 1501 TGGGCCAGAG CATGAACATG GGCAGTGACT TTGACGTCTT TGCCCACATC ACCAACAACA 1561 CCGCTGAGGA GTACGTCTGC CGCCTCCTGC TCTGTGCCCG CACCGTCAGC TACAATGGGA 1621 TCTTGGGGCC CGAGTGTGGC ACCAAGTACC TGCTCAACCT CAACCTGGAG CCTTTCTCTG 1681 GTAAAGCCCT GTGTTCCTGG AGCATTTGTT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1741 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1801 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATGGTA 1861 ACCACAAGTG CTACCTGCAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1921 tgaaagatt