Transcript: Human NM_001329457.2

Homo sapiens HORMA domain containing 2 (HORMAD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-11
Taxon:
Homo sapiens (human)
Gene:
HORMAD2 (150280)
Length:
1942
CDS:
111..1034

Additional Resources:

NCBI RefSeq record:
NM_001329457.2
NBCI Gene record:
HORMAD2 (150280)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443169 GTCCCGGGTCACTGCATATTA pLKO_005 340 CDS 100% 15.000 21.000 N HORMAD2 n/a
2 TRCN0000430038 CATAAGGAAAGCGGGTCAATA pLKO_005 1218 3UTR 100% 13.200 18.480 N HORMAD2 n/a
3 TRCN0000436233 GAATCCCTCTCTAGCTGTATT pLKO_005 1439 3UTR 100% 13.200 18.480 N HORMAD2 n/a
4 TRCN0000421037 GCTTATCCAGGTGTGATTTAT pLKO_005 1497 3UTR 100% 15.000 10.500 N HORMAD2 n/a
5 TRCN0000127782 GCAGCAGTACAAGCTTTGAAA pLKO.1 526 CDS 100% 5.625 3.938 N HORMAD2 n/a
6 TRCN0000127569 CAGTGTTCTACTGATCCGTAA pLKO.1 578 CDS 100% 4.050 2.835 N HORMAD2 n/a
7 TRCN0000127821 GAACAATCTGTTTCGGGAGAA pLKO.1 845 CDS 100% 4.050 2.835 N HORMAD2 n/a
8 TRCN0000128886 GAAGAAGAATGCAATGACCAT pLKO.1 909 CDS 100% 2.640 1.848 N HORMAD2 n/a
9 TRCN0000129462 GCAGTCAGCAAAGTTCTGAGT pLKO.1 952 CDS 100% 2.640 1.848 N HORMAD2 n/a
10 TRCN0000127726 GTTTGACAAGGAGCCTATCAA pLKO.1 740 CDS 100% 5.625 3.375 N HORMAD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05038 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05038 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467171 AATTCCAATACGTCGGGCCACCTA pLX_317 38% 100% 100% V5 n/a
Download CSV