Construct: ORF TRCN0000467187
Construct Description:
- Construct Type:
 - ORF
 - Other Identifiers:
 - ORF010965.1_s317c1
 - Derived from:
 - ccsbBroadEn_02026
 - DNA Barcode:
 - CAATAAAAAAATAATACGGATCCC
 - Epitope Tag:
 - V5
 - Notes:
 - No stop codon in insert
 
Originally Annotated References:
- Gene:
 - NRP1 (8829)
 
Vector Information:
- Vector Backbone:
 - pLX_317
 - Pol II Cassette 1:
 - SV40-PuroR
 - Pol II Cassette 2:
 - EF1a-TRCN0000467187
 - Selection Marker:
 - PuroR
 - Visible Reporter:
 - n/a
 - Epitope Tag:
 - n/a
 
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows:  total nt. matches ---------------------------------- aligned length (incl. gaps)  | 
              Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows:  total aa. matches ---------------------------------- aligned length (incl. gaps)  | 
              Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8829 | NRP1 | neuropilin 1 | NM_001024629.2 | 100% | 100% | |
| 2 | human | 8829 | NRP1 | neuropilin 1 | XM_011519756.2 | 96.7% | 96.3% | (many diffs) | 
| 3 | human | 8829 | NRP1 | neuropilin 1 | NM_001024628.2 | 94.5% | 94.5% | 1758_1862del | 
| 4 | human | 8829 | NRP1 | neuropilin 1 | XM_011519755.3 | 92.6% | 92.2% | (many diffs) | 
| 5 | human | 8829 | NRP1 | neuropilin 1 | XM_006717526.2 | 91.6% | 91.2% | (many diffs) | 
| 6 | human | 8829 | NRP1 | neuropilin 1 | XM_006717525.2 | 68.4% | 68.1% | (many diffs) | 
| 7 | human | 8829 | NRP1 | neuropilin 1 | XM_006717524.2 | 68.3% | 68% | (many diffs) | 
| 8 | human | 8829 | NRP1 | neuropilin 1 | XM_017016865.2 | 67.6% | 67.2% | (many diffs) | 
| 9 | human | 8829 | NRP1 | neuropilin 1 | NM_001330068.1 | 67.1% | 66.8% | (many diffs) | 
| 10 | human | 8829 | NRP1 | neuropilin 1 | XM_006717522.2 | 67% | 66.7% | (many diffs) | 
| 11 | human | 8829 | NRP1 | neuropilin 1 | NM_001244973.1 | 66.4% | 66.1% | (many diffs) | 
| 12 | human | 8829 | NRP1 | neuropilin 1 | NM_001244972.1 | 66.3% | 66% | (many diffs) | 
| 13 | human | 8829 | NRP1 | neuropilin 1 | NM_003873.6 | 65.9% | 65.6% | (many diffs) | 
| 14 | human | 8829 | NRP1 | neuropilin 1 | XM_006717521.2 | 65.8% | 65.4% | (many diffs) | 
| 15 | human | 8829 | NRP1 | neuropilin 1 | XM_017016866.2 | 46.2% | 46% | (many diffs) | 
| 16 | human | 8829 | NRP1 | neuropilin 1 | NR_045259.1 | 27.9% | (many diffs) | |
| 17 | mouse | 18186 | Nrp1 | neuropilin 1 | XM_006530768.3 | 83.3% | 88.1% | (many diffs) | 
| 18 | mouse | 18186 | Nrp1 | neuropilin 1 | XM_006530767.2 | 57.3% | 60.5% | (many diffs) | 
| 19 | mouse | 18186 | Nrp1 | neuropilin 1 | NM_008737.2 | 56.8% | 60.1% | (many diffs) | 
| 20 | mouse | 18186 | Nrp1 | neuropilin 1 | XM_006530766.3 | 56.8% | 60.1% | (many diffs) | 
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
 - 66
 - ORF end:
 - 1893
 - ORF length:
 - 1827
 - Sequence:
 - 
          
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gagggggctg ccgctcctct gcgccgtgct cgccctcgtc ctcgccccgg 121 ccggcgcttt tcgcaacgat aaatgtggcg atactataaa aattgaaagc cccgggtacc 181 ttacatctcc tggttatcct cattcttatc acccaagtga aaaatgcgaa tggctgattc 241 aggctccgga cccataccag agaattatga tcaacttcaa ccctcacttc gatttggagg 301 acagagactg caagtatgac tacgtggaag tcttcgatgg agaaaatgaa aatggacatt 361 ttaggggaaa gttctgtgga aagatagccc ctcctcctgt tgtgtcttca gggccatttc 421 tttttatcaa atttgtctct gactacgaaa cacatggtgc aggattttcc atacgttatg 481 aaattttcaa gagaggtcct gaatgttccc agaactacac aacacctagt ggagtgataa 541 agtcccccgg attccctgaa aaatatccca acagccttga atgcacttat attgtctttg 601 cgccaaagat gtcagagatt atcctggaat ttgaaagctt tgacctggag cctgactcaa 661 atcctccagg ggggatgttc tgtcgctacg accggctaga aatctgggat ggattccctg 721 atgttggccc tcacattggg cgttactgtg gacagaaaac accaggtcga atccgatcct 781 catcgggcat tctctccatg gttttttaca ccgacagcgc gatagcaaaa gaaggtttct 841 cagcaaacta cagtgtcttg cagagcagtg tctcagaaga tttcaaatgt atggaagctc 901 tgggcatgga atcaggagaa attcattctg accagatcac agcttcttcc cagtatagca 961 ccaactggtc tgcagagcgc tcccgcctga actaccctga gaatgggtgg actcccggag 1021 aggattccta ccgagagtgg atacaggtag acttgggcct tctgcgcttt gtcacggctg 1081 tcgggacaca gggcgccatt tcaaaagaaa ccaagaagaa atattatgtc aagacttaca 1141 agatcgacgt tagctccaac ggggaagact ggatcaccat aaaagaagga aacaaacctg 1201 ttctctttca gggaaacacc aaccccacag atgttgtggt tgcagtattc cccaaaccac 1261 tgataactcg atttgtccga atcaagcctg caacttggga aactggcata tctatgagat 1321 ttgaagtata cggttgcaag ataacagatt atccttgctc tggaatgttg ggtatggtgt 1381 ctggacttat ttctgactcc cagatcacat catccaacca aggggacaga aactggatgc 1441 ctgaaaacat ccgcctggta accagtcgct ctggctgggc acttccaccc gcaccTCATT 1501 CCTACATCAA TGAGTGGCTC CAAATAGACC TGGGGGAGGA GAAGATCGTG AGGGGCATCA 1561 TCATTCAGGG TGGGAAGCAC CGAGAGAACA AGGTGTTCAT GAGGAAGTTC AAGATCGGGT 1621 ACAGCAACAA CGGCTCGGAC TGGAAGATGA TCATGGATGA CAGCAAACGC AAGGCGAAGT 1681 CTTTTGAGGG CAACAACAAC TATGATACAC CTGAGCTGCG GACTTTTCCA GCTCTCTCCA 1741 CGCGATTCAT CAGGATCTAC CCCGAGAGAG CCACTCATGG CGGACTGGGG CTCAGAATGG 1801 AGCTGCTGGG CTGTGAAGTG GAAGGTGGCA CCACTGTGCT GGCCACAGAA AAGCCCACGG 1861 TCATAGACAG CACCATACAA TCAGGTATCA AATACCCAAC TTTCTTGTAC AAAGTGGTTG 1921 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1981 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACA 2041 ATAAAAAAAT AATACGGATC CCACGCGTTA AGTCgacaat caacctctgg attacaaaat 2101 ttgtgaaaga tt