Transcript: Mouse NM_008737.2

Mus musculus neuropilin 1 (Nrp1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Nrp1 (18186)
Length:
5921
CDS:
488..3259

Additional Resources:

NCBI RefSeq record:
NM_008737.2
NBCI Gene record:
Nrp1 (18186)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029863 CCAATCAGAGTTCCCGACATA pLKO.1 2404 CDS 100% 4.950 6.930 N Nrp1 n/a
2 TRCN0000029860 GCCCGAATGTTCTCAGAACTA pLKO.1 919 CDS 100% 4.950 6.930 N Nrp1 n/a
3 TRCN0000337570 GCCCTCACATTGGGCGTTATT pLKO_005 1149 CDS 100% 13.200 10.560 N Nrp1 n/a
4 TRCN0000337506 AGCACCTACTGGAGTGATAAA pLKO_005 943 CDS 100% 13.200 9.240 N Nrp1 n/a
5 TRCN0000337571 CAGTATTAACAACCATATTTC pLKO_005 2881 CDS 100% 13.200 9.240 N Nrp1 n/a
6 TRCN0000337572 CTGAAACTATATCAGGTTATT pLKO_005 2807 CDS 100% 13.200 9.240 N Nrp1 n/a
7 TRCN0000029862 CCCACCCATACACCAATGAAT pLKO.1 1917 CDS 100% 5.625 3.938 N Nrp1 n/a
8 TRCN0000029859 CCTGCTTTCTTCTCTTGGTTT pLKO.1 3499 3UTR 100% 4.950 3.465 N Nrp1 n/a
9 TRCN0000337505 CCTGCTTTCTTCTCTTGGTTT pLKO_005 3499 3UTR 100% 4.950 3.465 N Nrp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02027 pDONR223 100% 60.3% 63.8% None (many diffs) n/a
2 ccsbBroad304_02027 pLX_304 0% 60.3% 63.8% V5 (many diffs) n/a
3 ccsbBroadEn_02026 pDONR223 100% 56.8% 60.1% None (many diffs) n/a
4 ccsbBroad304_02026 pLX_304 0% 56.8% 60.1% V5 (many diffs) n/a
5 TRCN0000467187 CAATAAAAAAATAATACGGATCCC pLX_317 22% 56.8% 60.1% V5 (many diffs) n/a
Download CSV