Transcript: Human XM_011519756.2

PREDICTED: Homo sapiens neuropilin 1 (NRP1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRP1 (8829)
Length:
2503
CDS:
271..2157

Additional Resources:

NCBI RefSeq record:
XM_011519756.2
NBCI Gene record:
NRP1 (8829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519756.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063527 CAGCCTTGAATGCACTTATAT pLKO.1 777 CDS 100% 15.000 10.500 N NRP1 n/a
2 TRCN0000300917 CAGCCTTGAATGCACTTATAT pLKO_005 777 CDS 100% 15.000 10.500 N NRP1 n/a
3 TRCN0000063524 CGGACCCATACCAGAGAATTA pLKO.1 452 CDS 100% 13.200 9.240 N NRP1 n/a
4 TRCN0000063526 CCGAGAGAACAAGGTGTTCAT pLKO.1 1785 CDS 100% 4.950 3.465 N NRP1 n/a
5 TRCN0000063523 GCAACGATAAATGTGGCGATA pLKO.1 338 CDS 100% 4.050 2.835 N NRP1 n/a
6 TRCN0000322982 TAAATGTGGCGATACTATAAA pLKO_005 345 CDS 100% 15.000 9.000 N NRP1 n/a
7 TRCN0000337570 GCCCTCACATTGGGCGTTATT pLKO_005 932 CDS 100% 13.200 18.480 N Nrp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519756.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02026 pDONR223 100% 96.7% 96.3% None (many diffs) n/a
2 ccsbBroad304_02026 pLX_304 0% 96.7% 96.3% V5 (many diffs) n/a
3 TRCN0000467187 CAATAAAAAAATAATACGGATCCC pLX_317 22% 96.7% 96.3% V5 (many diffs) n/a
4 ccsbBroadEn_02027 pDONR223 100% 91.6% 91.2% None (many diffs) n/a
5 ccsbBroad304_02027 pLX_304 0% 91.6% 91.2% V5 (many diffs) n/a
Download CSV