Construct: ORF TRCN0000467292
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006276.1_s317c1
- Derived from:
- ccsbBroadEn_13273
- DNA Barcode:
- CCCTATGAAGGCCTGAAGCGGGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- METTL21A (151194)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467292
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 151194 | METTL21A | methyltransferase like 21A | NM_001330131.2 | 100% | 100% | |
| 2 | human | 151194 | METTL21A | methyltransferase like 21A | NM_001330133.1 | 100% | 100% | |
| 3 | human | 151194 | METTL21A | methyltransferase like 21A | NM_001330135.2 | 100% | 100% | |
| 4 | human | 151194 | METTL21A | methyltransferase like 21A | XM_017003446.1 | 86.9% | 86.4% | (many diffs) |
| 5 | human | 151194 | METTL21A | methyltransferase like 21A | XM_017003447.1 | 86.9% | 86.4% | (many diffs) |
| 6 | human | 151194 | METTL21A | methyltransferase like 21A | XM_024452726.1 | 83.3% | 83.3% | 259_312del |
| 7 | human | 151194 | METTL21A | methyltransferase like 21A | XM_017003445.1 | 78.2% | 78.2% | 1_75del |
| 8 | human | 151194 | METTL21A | methyltransferase like 21A | NM_001308021.3 | 69.9% | 68.5% | (many diffs) |
| 9 | human | 151194 | METTL21A | methyltransferase like 21A | NM_001330132.1 | 69.9% | 68.5% | (many diffs) |
| 10 | human | 151194 | METTL21A | methyltransferase like 21A | NM_001330136.1 | 69.9% | 68.5% | (many diffs) |
| 11 | human | 151194 | METTL21A | methyltransferase like 21A | XM_024452724.1 | 69.9% | 68.5% | (many diffs) |
| 12 | human | 151194 | METTL21A | methyltransferase like 21A | XM_024452725.1 | 69.9% | 68.5% | (many diffs) |
| 13 | human | 151194 | METTL21A | methyltransferase like 21A | XM_017003444.1 | 69.8% | 69.5% | (many diffs) |
| 14 | human | 151194 | METTL21A | methyltransferase like 21A | XM_011510729.2 | 67.6% | 67.6% | 1_75del;334_387del |
| 15 | human | 151194 | METTL21A | methyltransferase like 21A | XM_011510727.3 | 58.5% | 57.2% | (many diffs) |
| 16 | human | 151194 | METTL21A | methyltransferase like 21A | XM_011510728.3 | 58.5% | 57.2% | (many diffs) |
| 17 | human | 151194 | METTL21A | methyltransferase like 21A | NM_001127395.3 | 41.1% | 39.9% | (many diffs) |
| 18 | human | 151194 | METTL21A | methyltransferase like 21A | NM_001330130.2 | 41.1% | 39.9% | (many diffs) |
| 19 | human | 151194 | METTL21A | methyltransferase like 21A | NM_001330134.1 | 41.1% | 39.9% | (many diffs) |
| 20 | human | 151194 | METTL21A | methyltransferase like 21A | NM_145280.6 | 41.1% | 39.9% | (many diffs) |
| 21 | human | 151194 | METTL21A | methyltransferase like 21A | XM_005246339.4 | 41.1% | 39.9% | (many diffs) |
| 22 | human | 151194 | METTL21A | methyltransferase like 21A | XM_005246340.4 | 41.1% | 39.9% | (many diffs) |
| 23 | human | 151194 | METTL21A | methyltransferase like 21A | XM_024452722.1 | 41.1% | 39.9% | (many diffs) |
| 24 | human | 151194 | METTL21A | methyltransferase like 21A | XM_024452723.1 | 41.1% | 39.9% | (many diffs) |
| 25 | human | 151194 | METTL21A | methyltransferase like 21A | NM_001330137.1 | 37.1% | 36.4% | (many diffs) |
| 26 | human | 151194 | METTL21A | methyltransferase like 21A | XM_005246336.3 | 37.1% | 36.4% | (many diffs) |
| 27 | human | 151194 | METTL21A | methyltransferase like 21A | XM_005246337.4 | 37.1% | 36.4% | (many diffs) |
| 28 | human | 151194 | METTL21A | methyltransferase like 21A | XM_006712327.3 | 37.1% | 36.4% | (many diffs) |
| 29 | human | 151194 | METTL21A | methyltransferase like 21A | XM_024452721.1 | 37.1% | 36.4% | (many diffs) |
| 30 | human | 151194 | METTL21A | methyltransferase like 21A | XM_011510725.2 | 36.8% | 35.8% | (many diffs) |
| 31 | human | 151194 | METTL21A | methyltransferase like 21A | XM_011510724.2 | 33.6% | 32.9% | (many diffs) |
| 32 | mouse | 67099 | Mettl21a | methyltransferase like 21A | NM_025964.3 | 35.9% | 36.2% | (many diffs) |
| 33 | mouse | 67099 | Mettl21a | methyltransferase like 21A | XM_006496203.3 | 35.9% | 36.2% | (many diffs) |
| 34 | mouse | 67099 | Mettl21a | methyltransferase like 21A | XM_006496204.3 | 35.9% | 36.2% | (many diffs) |
| 35 | mouse | 67099 | Mettl21a | methyltransferase like 21A | XR_001785519.1 | 11.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 336
- ORF length:
- 270
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cctcgtgccc tatgaggaga ccacggaatt tgggttgcag aaattccaca 121 agcctcttgc aactttttcc tttgcaaacc acacgatcca gatccggcag gactggagac 181 acctgggagt cgcagcggtg gtttgggatg cggccatcgt tctttccaca tacctGGAGA 241 TGGGAGCTGT GGAGCTCAGG GGCCGCTCTG CCGTGGAGCT GGGTGCTGGC ACGGGGCTGG 301 TGGGCATAGT GGCTGCCCTG CTGGGAGGTG GAATTTACCC AACTTTCTTG TACAAAGTGG 361 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 421 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 481 ACCCTATGAA GGCCTGAAGC GGGCAACGCG TTAAGTCgac aatcaacctc tggattacaa 541 aatttgtgaa agatt