Transcript: Human XM_024452722.1

PREDICTED: Homo sapiens methyltransferase like 21A (METTL21A), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
METTL21A (151194)
Length:
2476
CDS:
190..846

Additional Resources:

NCBI RefSeq record:
XM_024452722.1
NBCI Gene record:
METTL21A (151194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263894 ATTCGCTATGAACGGGATAAC pLKO_005 712 CDS 100% 10.800 15.120 N METTL21A n/a
2 TRCN0000263895 CAAACGTTCAAGCCAACTTAC pLKO_005 500 CDS 100% 10.800 15.120 N METTL21A n/a
3 TRCN0000263896 GAGGACTTATAATTGGCTATA pLKO_005 835 CDS 100% 10.800 15.120 N METTL21A n/a
4 TRCN0000263892 CTTGGTGCTGATATCATATAT pLKO_005 610 CDS 100% 15.000 10.500 N METTL21A n/a
5 TRCN0000263893 GCCTTAATTTCAGGTATATAT pLKO_005 1405 3UTR 100% 15.000 10.500 N METTL21A n/a
6 TRCN0000167477 GAAGAAACATTCACAGATCTT pLKO.1 634 CDS 100% 4.950 3.465 N METTL21A n/a
7 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1679 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09678 pDONR223 100% 99.6% 99.5% None 471G>A;575C>T n/a
2 TRCN0000468870 AATCTGTCAGAGGCGTTTCTTGGA pLX_317 68.8% 99.6% 99.5% V5 471G>A;575C>T n/a
3 ccsbBroadEn_13273 pDONR223 100% 41.1% 39.9% None (many diffs) n/a
4 ccsbBroad304_13273 pLX_304 0% 41.1% 39.9% V5 (many diffs) n/a
5 TRCN0000467292 CCCTATGAAGGCCTGAAGCGGGCA pLX_317 38.2% 41.1% 39.9% V5 (many diffs) n/a
Download CSV