Transcript: Human XM_024452724.1

PREDICTED: Homo sapiens methyltransferase like 21A (METTL21A), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
METTL21A (151194)
Length:
1215
CDS:
363..746

Additional Resources:

NCBI RefSeq record:
XM_024452724.1
NBCI Gene record:
METTL21A (151194)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13273 pDONR223 100% 69.9% 68.5% None (many diffs) n/a
2 ccsbBroad304_13273 pLX_304 0% 69.9% 68.5% V5 (many diffs) n/a
3 TRCN0000467292 CCCTATGAAGGCCTGAAGCGGGCA pLX_317 38.2% 69.9% 68.5% V5 (many diffs) n/a
4 ccsbBroadEn_09678 pDONR223 100% 54.7% 42.1% None (many diffs) n/a
5 TRCN0000468870 AATCTGTCAGAGGCGTTTCTTGGA pLX_317 68.8% 54.7% 42.1% V5 (many diffs) n/a
Download CSV