Transcript: Mouse XM_006496204.3

PREDICTED: Mus musculus methyltransferase like 21A (Mettl21a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mettl21a (67099)
Length:
3558
CDS:
1640..2296

Additional Resources:

NCBI RefSeq record:
XM_006496204.3
NBCI Gene record:
Mettl21a (67099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496204.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264551 TACTTGGAGCTGATGTCATAT pLKO_005 2058 CDS 100% 13.200 18.480 N Mettl21a n/a
2 TRCN0000281639 CGCTATGAACGGGATAGTAAC pLKO_005 2165 CDS 100% 10.800 15.120 N Mettl21a n/a
3 TRCN0000264553 AGTCTGTATTGTACCTATAAT pLKO_005 3123 3UTR 100% 15.000 10.500 N Mettl21a n/a
4 TRCN0000264552 GGACTTGTAGCGGGCAGTATT pLKO_005 2287 CDS 100% 13.200 9.240 N Mettl21a n/a
5 TRCN0000264554 ACGGATCGGAAAGTAGCATTA pLKO_005 1916 CDS 100% 10.800 7.560 N Mettl21a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496204.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09678 pDONR223 100% 88.8% 89.4% None (many diffs) n/a
2 TRCN0000468870 AATCTGTCAGAGGCGTTTCTTGGA pLX_317 68.8% 88.8% 89.4% V5 (many diffs) n/a
3 ccsbBroadEn_13273 pDONR223 100% 35.9% 36.2% None (many diffs) n/a
4 ccsbBroad304_13273 pLX_304 0% 35.9% 36.2% V5 (many diffs) n/a
5 TRCN0000467292 CCCTATGAAGGCCTGAAGCGGGCA pLX_317 38.2% 35.9% 36.2% V5 (many diffs) n/a
Download CSV