Construct: ORF TRCN0000467319
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003940.1_s317c1
- Derived from:
- ccsbBroadEn_02957
- DNA Barcode:
- CACTAATCTAATCTTCGCCGCAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OR7A17 (26333)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467319
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26333 | OR7A17 | olfactory receptor family 7... | NM_030901.1 | 100% | 100% | |
| 2 | human | 390892 | OR7A10 | olfactory receptor family 7... | NM_001005190.1 | 87% | 82.5% | (many diffs) |
| 3 | human | 26659 | OR7A5 | olfactory receptor family 7... | NM_001370480.1 | 84% | 77.4% | (many diffs) |
| 4 | human | 26659 | OR7A5 | olfactory receptor family 7... | NM_001370481.1 | 84% | 77.4% | (many diffs) |
| 5 | human | 26659 | OR7A5 | olfactory receptor family 7... | NM_001370482.1 | 84% | 77.4% | (many diffs) |
| 6 | human | 26659 | OR7A5 | olfactory receptor family 7... | NM_001370483.1 | 84% | 77.4% | (many diffs) |
| 7 | human | 26659 | OR7A5 | olfactory receptor family 7... | NM_017506.2 | 84% | 77.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 996
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaaccagag aatgacacag ggatttcaga atttgttctt ctgggacttt 121 ctgaggaacc agaattgcag cccttcctct ttgggctgtt tctgtccatg tacctggtca 181 ctgtgctcgg gaatctgctc atcatcctgg ccacaatctc agactcccac ctccacaccc 241 ccatgtactt cttcctctcc aacctgtcct ttgcagacat ctgtttcatc tccactacaa 301 tcccaaagat gctcattaac atccagacac agagcagagt catcacctat gcaggctgca 361 tcacccagat gtgctttttt gtactttttg gagggttaga cagcttactc ctggctgtga 421 tggcctatga tcggtttgtg gccatctgtc atcctctgca ctacacagtc atcatgaacc 481 ctcggctctg tggactcctg gttctggcat cctggatgat tgctgccctg aattccttgt 541 cacaaagctt aatggtattg tggctgtcct tctgcacaga cttggaaatc ccccactttt 601 tctgtgaact taatcaggtc atccaccttg cctgttctga cacctttctt aatgacatgg 661 ggatgtattt tgcagcaggg ctgctggctg gtggTCCCCT TGTGGGGATC CTTTGCTCTT 721 ACTCTAAGAT AGTTTCCTCC ATACGTGCAA TCTCATCAGC TCAGGGGAAG TACAAGGCAT 781 TTTCCACCTG TGCATCACAC CTCTCAGTTG TCTCTTTATT TTGTTGTACG GGCCTAGGTG 841 TGTACCTTAC TTCTGCTGCA ACCCACAACT CACACACAAG TGCAACAGCC TCAGTGATGT 901 ACACTGTGGC CACCCCCATG CTGAACCCCT TTATCTACAG TCTGAGGAAT AAAGACATAA 961 AGAGGGCTCT GAAAATGTCC TTCAGAGGAA AGCAATTGCC AACTTTCTTG TACAAAGTGG 1021 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1081 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1141 ACACTAATCT AATCTTCGCC GCAAAACGCG TTAAGTCgac aatcaacctc tggattacaa 1201 aatttgtgaa agatt