Transcript: Human NM_001370482.1

Homo sapiens olfactory receptor family 7 subfamily A member 5 (OR7A5), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
OR7A5 (26659)
Length:
2287
CDS:
287..1246

Additional Resources:

NCBI RefSeq record:
NM_001370482.1
NBCI Gene record:
OR7A5 (26659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370482.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009440 GCTCTGTATTCCTTGCTACAA pLKO.1 743 CDS 100% 4.950 6.930 N OR7A5 n/a
2 TRCN0000363223 CTTAATCACATGGTGATATAT pLKO_005 866 CDS 100% 15.000 10.500 N OR7A5 n/a
3 TRCN0000363219 TCTGTATTCCTTGCTACAAAT pLKO_005 745 CDS 100% 13.200 9.240 N OR7A5 n/a
4 TRCN0000363228 TCAAGGTTATTTCCGACTTTG pLKO_005 1461 3UTR 100% 10.800 7.560 N OR7A5 n/a
5 TRCN0000009439 CCTGTGGCATAGACTACACTT pLKO.1 1539 3UTR 100% 4.950 3.465 N OR7A5 n/a
6 TRCN0000009441 CCTTTGCTGACATTTGTGTTA pLKO.1 486 CDS 100% 4.950 3.465 N OR7A5 n/a
7 TRCN0000009442 CTGATAGCTTTCTTAATCACA pLKO.1 855 CDS 100% 3.000 2.100 N OR7A5 n/a
8 TRCN0000011793 CCACCCGCAACTCACACTCAA pLKO.1 1077 CDS 100% 1.650 1.155 N OR7A5 n/a
9 TRCN0000363211 ATATGACCTGAGACCACAATT pLKO_005 1595 3UTR 100% 13.200 7.920 N OR7A5 n/a
10 TRCN0000187162 CACCTCTCAGTTGTCTCCTTA pLKO.1 1016 CDS 100% 4.950 2.475 Y Olfr57 n/a
11 TRCN0000009348 CCCATGTACTTCTTCCTCTCA pLKO.1 458 CDS 100% 2.640 1.320 Y OR2A4 n/a
12 TRCN0000189182 CCCATGTACTTCTTCCTCTCT pLKO.1 458 CDS 100% 2.640 1.320 Y Olfr444 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370482.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08034 pDONR223 100% 99.8% 100% None 438A>G n/a
2 ccsbBroad304_08034 pLX_304 0% 99.8% 100% V5 438A>G n/a
3 TRCN0000476174 CTCAACAGGGGAATCCGTTACGGA pLX_317 33.4% 99.8% 100% V5 438A>G n/a
4 ccsbBroadEn_02957 pDONR223 100% 84% 77.4% None (many diffs) n/a
5 ccsbBroad304_02957 pLX_304 0% 84% 77.4% V5 (many diffs) n/a
6 TRCN0000467319 CACTAATCTAATCTTCGCCGCAAA pLX_317 32.8% 84% 77.4% V5 (many diffs) n/a
Download CSV