Construct: ORF TRCN0000467344
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001629.3_s317c1
- Derived from:
- ccsbBroadEn_14776
- DNA Barcode:
- CAACACGAGGCCATACATTGCTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRKAA1 (5562)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467344
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5562 | PRKAA1 | protein kinase AMP-activate... | NM_006251.5 | 98.3% | 98.3% | 1_27del |
| 2 | human | 5562 | PRKAA1 | protein kinase AMP-activate... | NM_206907.3 | 95.8% | 95.8% | 1_27del;363_407del |
| 3 | human | 5562 | PRKAA1 | protein kinase AMP-activate... | NM_001355028.2 | 95.7% | 93.3% | (many diffs) |
| 4 | human | 5562 | PRKAA1 | protein kinase AMP-activate... | XM_017009625.2 | 95.7% | 93.3% | (many diffs) |
| 5 | human | 5562 | PRKAA1 | protein kinase AMP-activate... | XM_017009624.1 | 93.2% | 90.8% | (many diffs) |
| 6 | human | 5562 | PRKAA1 | protein kinase AMP-activate... | NM_001355029.2 | 75.4% | 75.4% | 0_1ins405 |
| 7 | human | 5562 | PRKAA1 | protein kinase AMP-activate... | NM_001355035.2 | 54.7% | 54.7% | 0_1ins747 |
| 8 | human | 5562 | PRKAA1 | protein kinase AMP-activate... | NM_001355036.2 | 54.7% | 54.7% | 0_1ins747 |
| 9 | human | 5562 | PRKAA1 | protein kinase AMP-activate... | NM_001355037.2 | 54.7% | 54.7% | 0_1ins747 |
| 10 | human | 5562 | PRKAA1 | protein kinase AMP-activate... | NM_001355034.1 | 35.8% | 33.3% | (many diffs) |
| 11 | mouse | 105787 | Prkaa1 | protein kinase, AMP-activat... | NM_001013367.3 | 88.6% | 97.1% | (many diffs) |
| 12 | mouse | 105787 | Prkaa1 | protein kinase, AMP-activat... | XM_011245321.2 | 74.9% | 82% | (many diffs) |
| 13 | mouse | 105787 | Prkaa1 | protein kinase, AMP-activat... | XM_017316356.1 | 74.9% | 82% | (many diffs) |
| 14 | mouse | 105787 | Prkaa1 | protein kinase, AMP-activat... | XM_006519953.2 | 67.6% | 74.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1716
- ORF length:
- 1650
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gacagccgag aagcagaaac acgacgggcg ggtgaagatc ggccactaca 121 ttctgggtga cacgctgggg gtcggcacct tcggcaaagt gaaggttggc aaacatgaat 181 tgactgggca taaagtagct gtgaagatac tcaatcgaca gaagattcgg agccttgatg 241 tggtaggaaa aatccgcaga gaaattcaga acctcaagct tttcaggcat cctcatataa 301 ttaaactgta ccaggtcatc agtacaccat ctgatatttt catggtgatg gaatatgtct 361 caggaggaga gctatttgat tatatctgta agaatggaag gctggatgaa aaagaaagtc 421 ggcgtctgtt ccaacagatc ctttctggtg tggattattg tcacaggcat atggtggtcc 481 atagagattt gaaacctgaa aatgtcctgc ttgatgcaca catgaatgca aagatagctg 541 attttggtct ttcaaacatg atgtcagatg gtgaattttt aagaacaagt tgtggctcac 601 ccaactatgc tgcaccagaa gtaatttcag gaagattgta tgcaggccca gaggtagata 661 tatggagcag tggggttatt ctctatgctt tattatgtgg aacccttcca tttgatgatg 721 accatgtgcc aactcttttt aagaagatat gtgatgggat cttctatacc cctcaatatt 781 taaatccttc tgtgattagc cttttgaaac atatgctgca ggtggatccc atgaagaggg 841 ccacaatcaa agatatcagg gaacatgaat ggtttaaaca ggaccttcca aaatatctct 901 ttcctgagga tccatcatat agttcaacca tgattgatga tgaagcctta aaagaagtat 961 gtgaaaagtt tgagtgctca gaagaggaag ttctcagctg tctttacaac agaaatcacc 1021 aggatccttt ggcagttgcc taccatctca taatagataa caggagaata atgaatgaag 1081 ccaaagattt ctatttggcg acaagcccac ctgattcttt tcttgatgat catcacctga 1141 ctcggcccca tcctgaaaga gtaccattct tggttgctga aacaccaagg gcacgccata 1201 cccttgatga attaaatcca cagaaatcca aacaccaagg tgtaaggaaa gcaaaatggc 1261 atttaggaat tagaagtcaa agtcgaccaa atgatattat ggcagaagta tgtagagcaa 1321 tcaaacaatt ggattatgaa tggaaggttg taaacccata ttatttgcgt gtacgaagga 1381 agaatcctgt gacaagcact tactccaaaa tgagtctaca gttataccaa gtggatagta 1441 gaacttatct actgGATTTC CGTAGTATTG ATGATGAAAT TACAGAAGCC AAATCAGGGA 1501 CTGCTACTCC ACAGAGATCG GGATCAGTTA GCAACTATCG ATCTTGCCAA AGGAGTGATT 1561 CAGATGCTGA GGCTCAAGGA AAATCCTCAG AAGTTTCTCT TACCTCATCT GTGACCTCAC 1621 TTGACTCTTC TCCTGTTGAC CTAACTCCAA GACCTGGAAG TCACACAATA GAATTTTTTG 1681 AGATGTGTGC AAATCTAATT AAAATTCTTG CACAATACCC AACTTTCTTG TACAAAGTGG 1741 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1801 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1861 ACAACACGAG GCCATACATT GCTTAACGCG TTAAGTCgac aatcaacctc tggattacaa 1921 aatttgtgaa agatt