Transcript: Human NM_001355028.2

Homo sapiens protein kinase AMP-activated catalytic subunit alpha 1 (PRKAA1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PRKAA1 (5562)
Length:
5363
CDS:
373..1974

Additional Resources:

NCBI RefSeq record:
NM_001355028.2
NBCI Gene record:
PRKAA1 (5562)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000861 GTTGCCTACCATCTCATAATA pLKO.1 1291 CDS 100% 15.000 21.000 N PRKAA1 n/a
2 TRCN0000219691 CTACTGGATTTCCGTAGTATT pLKO.1 1705 CDS 100% 13.200 18.480 N PRKAA1 n/a
3 TRCN0000196831 GCACAGACAATTGCAGTAAAT pLKO.1 4480 3UTR 100% 13.200 18.480 N PRKAA1 n/a
4 TRCN0000219690 GAAGGTTGTAAACCCATATTA pLKO.1 1599 CDS 100% 15.000 10.500 N PRKAA1 n/a
5 TRCN0000000860 TGATTGATGATGAAGCCTTAA pLKO.1 1187 CDS 100% 10.800 7.560 N PRKAA1 n/a
6 TRCN0000000859 CCTGGAAGTCACACAATAGAA pLKO.1 1909 CDS 100% 5.625 3.938 N PRKAA1 n/a
7 TRCN0000199831 GTGACCTCACTTGACTCTTCT pLKO.1 1867 CDS 100% 4.950 3.465 N PRKAA1 n/a
8 TRCN0000220675 CCACAGAAATCCAAACACCAA pLKO.1 1474 CDS 100% 2.640 1.848 N Prkaa1 n/a
9 TRCN0000000858 CCATCCTGAAAGAGTACCATT pLKO.1 1404 CDS 100% 4.950 2.970 N PRKAA1 n/a
10 TRCN0000196482 GTAGCTGTGAAGATACTCAAT pLKO.1 451 CDS 100% 4.950 2.970 N PRKAA1 n/a
11 TRCN0000000857 GCATAATAAGTCACAGCCAAA pLKO.1 2014 3UTR 100% 4.050 2.430 N PRKAA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15537 pDONR223 0% 95.7% 93.3% None (many diffs) n/a
2 ccsbBroad304_15537 pLX_304 0% 95.7% 93.3% V5 (many diffs) n/a
3 TRCN0000478669 TACTGCCCTATGTTTCTGCTAAAA pLX_317 21.5% 95.7% 93.3% V5 (many diffs) n/a
4 ccsbBroadEn_14776 pDONR223 0% 95.7% 93.3% None (many diffs) n/a
5 ccsbBroad304_14776 pLX_304 34.3% 95.7% 93.3% V5 (many diffs) n/a
6 TRCN0000467344 CAACACGAGGCCATACATTGCTTA pLX_317 16.2% 95.7% 93.3% V5 (many diffs) n/a
7 TRCN0000488972 CAACTGTTTAGCCTTTCCCAGCGT pLX_317 22.6% 95.7% 93.3% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488385 AGCTCTACCCCCTAAAGAGATTGT pLX_317 21.4% 95.7% 93.1% V5 (many diffs) n/a
9 TRCN0000488641 AGGTCCCCGCAGGTATGCTCCGTT pLX_317 22.6% 95.7% 93.1% V5 (not translated due to prior stop codon) (many diffs) n/a
10 ccsbBroadEn_06770 pDONR223 100% 91.6% 89.4% None (many diffs) n/a
11 ccsbBroad304_06770 pLX_304 32.8% 91.6% 89.4% V5 (many diffs) n/a
12 TRCN0000471900 GAGACCCCTGCACCTGCAGGCCCT pLX_317 28.6% 91.6% 89.4% V5 (many diffs) n/a
Download CSV