Transcript: Mouse XM_011245321.2

PREDICTED: Mus musculus protein kinase, AMP-activated, alpha 1 catalytic subunit (Prkaa1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkaa1 (105787)
Length:
4213
CDS:
239..1615

Additional Resources:

NCBI RefSeq record:
XM_011245321.2
NBCI Gene record:
Prkaa1 (105787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360842 CACGAGTTGACCGGACATAAA pLKO_005 71 5UTR 100% 13.200 18.480 N Prkaa1 n/a
2 TRCN0000220672 GCAATCAAGCAGTTGGATTAT pLKO.1 1214 CDS 100% 13.200 18.480 N Prkaa1 n/a
3 TRCN0000360841 TTGTTGGATTTCCGTAGTATT pLKO_005 1346 CDS 100% 13.200 18.480 N Prkaa1 n/a
4 TRCN0000360770 GAATCCTCATAGACCTTATTA pLKO_005 2004 3UTR 100% 15.000 12.000 N Prkaa1 n/a
5 TRCN0000360769 GACCATAAATTTACCATAAAG pLKO_005 1919 3UTR 100% 13.200 9.240 N Prkaa1 n/a
6 TRCN0000220674 CGTAGTATTGATGATGAGATT pLKO.1 1358 CDS 100% 4.950 3.465 N Prkaa1 n/a
7 TRCN0000220671 CCCATCTTATAGTTCAACCAT pLKO.1 808 CDS 100% 3.000 2.100 N Prkaa1 n/a
8 TRCN0000220675 CCACAGAAATCCAAACACCAA pLKO.1 1115 CDS 100% 2.640 1.584 N Prkaa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15537 pDONR223 0% 74.9% 82% None (many diffs) n/a
2 ccsbBroad304_15537 pLX_304 0% 74.9% 82% V5 (many diffs) n/a
3 TRCN0000478669 TACTGCCCTATGTTTCTGCTAAAA pLX_317 21.5% 74.9% 82% V5 (many diffs) n/a
4 ccsbBroadEn_14776 pDONR223 0% 74.9% 82% None (many diffs) n/a
5 ccsbBroad304_14776 pLX_304 34.3% 74.9% 82% V5 (many diffs) n/a
6 TRCN0000467344 CAACACGAGGCCATACATTGCTTA pLX_317 16.2% 74.9% 82% V5 (many diffs) n/a
7 TRCN0000488972 CAACTGTTTAGCCTTTCCCAGCGT pLX_317 22.6% 74.9% 82% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488385 AGCTCTACCCCCTAAAGAGATTGT pLX_317 21.4% 74.9% 81.8% V5 (many diffs) n/a
9 TRCN0000488641 AGGTCCCCGCAGGTATGCTCCGTT pLX_317 22.6% 74.9% 81.8% V5 (not translated due to prior stop codon) (many diffs) n/a
10 ccsbBroadEn_06770 pDONR223 100% 71.8% 78.5% None (many diffs) n/a
11 ccsbBroad304_06770 pLX_304 32.8% 71.8% 78.5% V5 (many diffs) n/a
12 TRCN0000471900 GAGACCCCTGCACCTGCAGGCCCT pLX_317 28.6% 71.8% 78.5% V5 (many diffs) n/a
Download CSV