Transcript: Human XM_005271712.3

PREDICTED: Homo sapiens ubiquitin associated and SH3 domain containing B (UBASH3B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBASH3B (84959)
Length:
9143
CDS:
2523..4556

Additional Resources:

NCBI RefSeq record:
XM_005271712.3
NBCI Gene record:
UBASH3B (84959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271712.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073151 GCGTTCAGACTGCACACAATA pLKO.1 4027 CDS 100% 13.200 18.480 N UBASH3B n/a
2 TRCN0000073148 CCGGCTTATTTGAGTGGACAA pLKO.1 4096 CDS 100% 4.050 5.670 N UBASH3B n/a
3 TRCN0000073150 GCCTGAGAATTACATTACCAA pLKO.1 3533 CDS 100% 3.000 4.200 N UBASH3B n/a
4 TRCN0000423202 GAATGCAGCACCTGGATATTT pLKO_005 3561 CDS 100% 15.000 10.500 N UBASH3B n/a
5 TRCN0000427144 ATTAGAGAGCAATACCATTAT pLKO_005 3974 CDS 100% 13.200 9.240 N UBASH3B n/a
6 TRCN0000427599 CATATTTCCTTTCACACTTAA pLKO_005 4669 3UTR 100% 13.200 9.240 N UBASH3B n/a
7 TRCN0000426360 CTCCAAGGACTTCGTACAAAT pLKO_005 4388 CDS 100% 13.200 9.240 N UBASH3B n/a
8 TRCN0000427820 GAGTGGTGGTTTCCGAGATTA pLKO_005 3890 CDS 100% 13.200 9.240 N UBASH3B n/a
9 TRCN0000073149 CCTCATAAGAAGCAGCTACAT pLKO.1 3222 CDS 100% 4.950 3.465 N UBASH3B n/a
10 TRCN0000073152 CCTGTGAAGAATTAGGAGAAA pLKO.1 4441 CDS 100% 4.950 2.970 N UBASH3B n/a
11 TRCN0000140238 GTCTCCCAAAGTGCTAGGATT pLKO.1 6248 3UTR 100% 4.950 2.475 Y PDZD7 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2 5UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 254 5UTR 100% 4.950 2.475 Y KAAG1 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271712.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04453 pDONR223 100% 91.3% 88.8% None (many diffs) n/a
2 ccsbBroad304_04453 pLX_304 0% 91.3% 88.8% V5 (many diffs) n/a
3 TRCN0000467371 CGTGAAGCTTCAAACGTCTTAAGC pLX_317 19.5% 91.3% 88.8% V5 (many diffs) n/a
Download CSV