Transcript: Mouse XM_006531608.3

PREDICTED: Mus musculus eukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked (Eif2s3y), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eif2s3y (26908)
Length:
2189
CDS:
40..1431

Additional Resources:

NCBI RefSeq record:
XM_006531608.3
NBCI Gene record:
Eif2s3y (26908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531608.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177113 GAAGCTTATGTGTAAACCAAT pLKO.1 960 CDS 100% 4.950 6.930 N Eif2s3y n/a
2 TRCN0000177232 GAAGGGAAGCTTATGTGTAAA pLKO.1 955 CDS 100% 13.200 9.240 N Eif2s3y n/a
3 TRCN0000177358 GAACAGATACTTGCATTTGTA pLKO.1 652 CDS 100% 5.625 3.938 N Eif2s3y n/a
4 TRCN0000197899 GAAGTACTCATGGTGAACATA pLKO.1 1243 CDS 100% 5.625 3.938 N Eif2s3y n/a
5 TRCN0000176716 CCTGAGATATTCACAGAGTTA pLKO.1 1132 CDS 100% 4.950 3.465 N Eif2s3y n/a
6 TRCN0000197990 CCTGATGAGTTTCCTTCAGAT pLKO.1 367 CDS 100% 4.950 2.970 N Eif2s3y n/a
7 TRCN0000136286 GCTGTGAAGTTGATGACCTTA pLKO.1 842 CDS 100% 4.950 2.970 N EIF2S3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531608.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13849 pDONR223 100% 85.7% 93.6% None (many diffs) n/a
2 ccsbBroad304_13849 pLX_304 0% 85.7% 93.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467776 TCATTTAGTGTGGCCCTGCCGTAC pLX_317 33.8% 85.7% 93.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV