Construct: ORF TRCN0000467899
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013940.1_s317c1
- Derived from:
- ccsbBroadEn_11343
- DNA Barcode:
- TTTTCATGACACTCACTGATGGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CBFA2T2 (9139)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467899
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9139 | CBFA2T2 | CBFA2/RUNX1 partner transcr... | XM_017028123.1 | 49.9% | 43.4% | (many diffs) |
| 2 | human | 9139 | CBFA2T2 | CBFA2/RUNX1 partner transcr... | XM_011529102.2 | 40.4% | 35.5% | (many diffs) |
| 3 | human | 9139 | CBFA2T2 | CBFA2/RUNX1 partner transcr... | NM_001039709.1 | 40.3% | 35.4% | (many diffs) |
| 4 | human | 9139 | CBFA2T2 | CBFA2/RUNX1 partner transcr... | XM_011529103.2 | 40.3% | 35.4% | (many diffs) |
| 5 | human | 9139 | CBFA2T2 | CBFA2/RUNX1 partner transcr... | XM_017028121.1 | 40.3% | 35.4% | (many diffs) |
| 6 | human | 9139 | CBFA2T2 | CBFA2/RUNX1 partner transcr... | XM_017028122.2 | 39.1% | 34.3% | (many diffs) |
| 7 | human | 9139 | CBFA2T2 | CBFA2/RUNX1 partner transcr... | NM_001032999.3 | 39% | 34.3% | (many diffs) |
| 8 | human | 9139 | CBFA2T2 | CBFA2/RUNX1 partner transcr... | NM_005093.3 | 38.5% | 33.8% | (many diffs) |
| 9 | human | 9139 | CBFA2T2 | CBFA2/RUNX1 partner transcr... | XM_011529101.2 | 37.8% | 33.3% | (many diffs) |
| 10 | mouse | 12396 | Cbfa2t2 | core-binding factor, runt d... | XM_006498640.2 | 37% | 37.8% | (many diffs) |
| 11 | mouse | 12396 | Cbfa2t2 | core-binding factor, runt d... | NM_009823.1 | 35.8% | 36.6% | (many diffs) |
| 12 | mouse | 12396 | Cbfa2t2 | core-binding factor, runt d... | NM_172860.2 | 35.7% | 36.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 855
- ORF length:
- 789
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca tggatcgcct gtggaagtga agatacagtc cagatcctca cctcccacca 121 tgccacccct cccaccaata aatcctggag gaccgaggcc agtgtccttc actcctactg 181 cattaagcaa tggcatcaac cattctcctc ctaccctgaa tggtgcccca tcaccgccac 241 agagattcag caatggtcct gcctcctcca catcatctgc actcacaaat cagcaattgc 301 cagccacttg tggtgctcga caactcagca agttgaaacg ctttcttacc actctgcaac 361 agtttggcaa tgacatctcc cctgagattg gggagaaggt gcggactctt gttcttgcac 421 tggtgaactc aacagtgaca attgaggaat tccactgtaa gctccaagaa gccacaaact 481 ttccccttcg tccttttgtg attccatttc tcaaggccaa cctgcccctg ctgcagcggg 541 aactgctgca ctgcgctcgg gcggccaagc agaccccatc ccagtacctg gctcagcacg 601 aacaccTTCT GCTCAACACA AGCATTGCAT CGCCTGCTGA CTCGTCAGAG TTGCTCATGG 661 AGGTGCACGG AAATGGGAAG AGGCCCAGTC CAGAGAGCTG CATAATACAT CTAAAATCTA 721 TGGGAGTAGC TTCCAGACAT GAGTATTTTT CGGGAACTCT TCAGATGCCT GCACACCCGG 781 TAAGAAACTC TACTCTAGAG AATTTATGGG TCGACTGTTC CAGAAGCCTC AGGAGTACAG 841 TTCTGCCTTT TCCTTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 901 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 961 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TTTTCATGAC ACTCACTGAT 1021 GGGCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt