Transcript: Human NM_005093.3

Homo sapiens CBFA2/RUNX1 partner transcriptional co-repressor 2 (CBFA2T2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
CBFA2T2 (9139)
Length:
7737
CDS:
538..2352

Additional Resources:

NCBI RefSeq record:
NM_005093.3
NBCI Gene record:
CBFA2T2 (9139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005093.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013367 GCGCTGAATTGCATTATGGAA pLKO.1 1597 CDS 100% 3.000 4.200 N CBFA2T2 n/a
2 TRCN0000218645 ATTACACCTTAGAGGATATTG pLKO_005 1415 CDS 100% 13.200 10.560 N CBFA2T2 n/a
3 TRCN0000013366 GCAAGTTGAAACGCTTTCTTA pLKO.1 887 CDS 100% 5.625 4.500 N CBFA2T2 n/a
4 TRCN0000013365 GCACGAATGGAGCAAACCATA pLKO.1 1963 CDS 100% 4.950 3.960 N CBFA2T2 n/a
5 TRCN0000230332 CATAGTTACAGGTCATTATAT pLKO_005 3451 3UTR 100% 15.000 10.500 N CBFA2T2 n/a
6 TRCN0000230331 CACCACAGTCTTGGTCTAAAT pLKO_005 1498 CDS 100% 13.200 9.240 N CBFA2T2 n/a
7 TRCN0000230330 GCATCGAGAAGTTCGTGATAG pLKO_005 1476 CDS 100% 10.800 7.560 N CBFA2T2 n/a
8 TRCN0000257110 TCTTGACCATGCGCTGAATTG pLKO_005 1587 CDS 100% 10.800 7.560 N CBFA2T2 n/a
9 TRCN0000013363 CCCACATTCTTCCCTGTCTTT pLKO.1 3672 3UTR 100% 4.950 3.465 N CBFA2T2 n/a
10 TRCN0000013364 CCCAACAAGATGCTAGAGCAT pLKO.1 1459 CDS 100% 2.640 1.848 N CBFA2T2 n/a
11 TRCN0000082462 CCTCCCAAAGTGCCAGGATTA pLKO.1 5244 3UTR 100% 10.800 5.400 Y LOC388949 n/a
12 TRCN0000139739 CCTTCTGAGTAGCTGGGATTA pLKO.1 5110 3UTR 100% 10.800 5.400 Y INAVA n/a
13 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4377 3UTR 100% 4.950 2.475 Y ORAI2 n/a
14 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3894 3UTR 100% 4.950 2.475 Y n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 383 5UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4374 3UTR 100% 4.950 2.475 Y LOC339059 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 383 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005093.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11342 pDONR223 100% 96.1% 95.7% None (many diffs) n/a
2 ccsbBroad304_11342 pLX_304 0% 96.1% 95.7% V5 (many diffs) n/a
3 TRCN0000467640 GGCTCATATTGGCAGGAGAAGAAG pLX_317 23.9% 96.1% 95.7% V5 (many diffs) n/a
4 ccsbBroadEn_11343 pDONR223 100% 38.5% 33.8% None (many diffs) n/a
5 ccsbBroad304_11343 pLX_304 0% 38.5% 33.8% V5 (many diffs) n/a
6 TRCN0000467899 TTTTCATGACACTCACTGATGGGC pLX_317 32% 38.5% 33.8% V5 (many diffs) n/a
Download CSV