Transcript: Mouse NM_011912.4

Mus musculus ventral anterior homeobox 2 (Vax2), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Mus musculus (mouse)
Gene:
Vax2 (24113)
Length:
1267
CDS:
59..937

Additional Resources:

NCBI RefSeq record:
NM_011912.4
NBCI Gene record:
Vax2 (24113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011912.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070873 CCCTACAGCAGACTAGAACAA pLKO.1 869 CDS 100% 4.950 3.960 N Vax2 n/a
2 TRCN0000070876 CGGAAGATTTGCGTGCTGACA pLKO.1 150 CDS 100% 2.640 2.112 N Vax2 n/a
3 TRCN0000422779 AGCTGAACCTCTCTGAGACTC pLKO_005 471 CDS 100% 4.050 2.835 N Vax2 n/a
4 TRCN0000412575 AGAGCAGCTGTATCGTCTGGA pLKO_005 391 CDS 100% 2.640 1.848 N Vax2 n/a
5 TRCN0000070877 TCGGGAAATTGTCTTGCCCAA pLKO.1 322 CDS 100% 2.160 1.512 N Vax2 n/a
6 TRCN0000070875 CCGCCGAACCAAGCAGAAGAA pLKO.1 514 CDS 100% 1.650 1.155 N Vax2 n/a
7 TRCN0000070874 CGCCGCATCCTGGTACGAGAT pLKO.1 287 CDS 100% 0.000 0.000 N Vax2 n/a
8 TRCN0000426956 AGACTGAACCAAATGACTTTG pLKO_005 1081 3UTR 100% 10.800 6.480 N Vax2 n/a
9 TRCN0000240652 TCTGGTTCCAGAACCGCCGAA pLKO_005 501 CDS 100% 0.720 0.360 Y Nkx1-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011912.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02858 pDONR223 100% 85.5% 87.3% None (many diffs) n/a
2 ccsbBroad304_02858 pLX_304 0% 85.5% 87.3% V5 (many diffs) n/a
3 TRCN0000467981 TCTAACTCTTCCACCTCCAGACAA pLX_317 38.6% 85.5% 87.3% V5 (many diffs) n/a
Download CSV