Construct: ORF TRCN0000468020
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001386.1_s317c1
- Derived from:
- ccsbBroadEn_04667
- DNA Barcode:
- CCTTCGTACCCTAACCATAAATCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- C1QTNF3 (114899)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468020
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 114899 | C1QTNF3 | C1q and TNF related 3 | NM_181435.6 | 100% | 100% | |
| 2 | human | 114899 | C1QTNF3 | C1q and TNF related 3 | NM_030945.4 | 77.1% | 77.1% | 82_83ins219 |
| 3 | human | 114899 | C1QTNF3 | C1q and TNF related 3 | NR_146599.1 | 20.7% | (many diffs) | |
| 4 | human | 100534612 | C1QTNF3-AMACR | C1QTNF3-AMACR readthrough (... | NR_037951.1 | 19.2% | (many diffs) | |
| 5 | mouse | 81799 | C1qtnf3 | C1q and tumor necrosis fact... | NM_001204134.1 | 90.9% | 93.1% | (many diffs) |
| 6 | mouse | 81799 | C1qtnf3 | C1q and tumor necrosis fact... | NM_030888.4 | 69.8% | 73.9% | (many diffs) |
| 7 | mouse | 81799 | C1qtnf3 | C1q and tumor necrosis fact... | XR_383836.3 | 37.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1026
- ORF length:
- 957
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctttggagg cagctcatct attggcaact gctggctttg tttttcctcc 121 ctttttgcct gtgtcaagat gaatacatgg aggtgagcgg aagaactaat aaagtggtgg 181 caagaatagt gcaaagccac cagcagactg gccgtagcgg ctccaggagg gagaaagtga 241 gagagcggag ccatcctaaa actgggactg tggataataa cacttctaca gacctaaaat 301 ccctgagacc agatgagcta ccgcaccccg aggtagatga cctagcccag atcaccacat 361 tctggggcca gtctccacaa accggaggac tacccccaga ctgcagtaag tgttgtcatg 421 gagactacag ctttcgaggc taccaaggcc cccctgggcc accgggccct cctggcattc 481 caggaaacca tggaaacaat ggcaacaatg gagccactgg tcatgaagga gccaaaggtg 541 agaagggcga caaaggtgac ctggggcctc gaggggagcg ggggcagcat ggccccaaag 601 gagagaaggg ctacccgggg attccaccag aacttcagat tgcattcatg gcttctctgg 661 caaccCACTT CAGCAATCAG AACAGTGGGA TTATCTTCAG CAGTGTTGAG ACCAACATTG 721 GAAACTTCTT TGATGTCATG ACTGGTAGAT TTGGGGCCCC AGTATCAGGT GTGTATTTCT 781 TCACCTTCAG CATGATGAAG CATGAGGATG TTGAGGAAGT GTATGTGTAC CTTATGCACA 841 ATGGCAACAC AGTCTTCAGC ATGTACAGCT ATGAAATGAA GGGCAAATCA GATACATCCA 901 GCAATCATGC TGTGCTGAAG CTAGCCAAAG GGGATGAGGT TTGGCTGCGA ATGGGCAATG 961 GCGCTCTCCA TGGGGACCAC CAACGCTTCT CCACCTTTGC AGGATTCCTG CTCTTTGAAA 1021 CTAAGTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1081 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1141 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACCTTCGTAC CCTAACCATA AATCCACGCG 1201 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt