Transcript: Mouse NM_001204134.1

Mus musculus C1q and tumor necrosis factor related protein 3 (C1qtnf3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
C1qtnf3 (81799)
Length:
2544
CDS:
98..1057

Additional Resources:

NCBI RefSeq record:
NM_001204134.1
NBCI Gene record:
C1qtnf3 (81799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001204134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257572 GAAGTGTATGTGTACCTTATG pLKO_005 845 CDS 100% 10.800 15.120 N C1qtnf3 n/a
2 TRCN0000371572 GAAGTGTATGTGTACCTTATG pLKO_005 845 CDS 100% 10.800 15.120 N C1QTNF3 n/a
3 TRCN0000179904 CCCACTTACTAGACTCTACAT pLKO.1 1587 3UTR 100% 4.950 3.960 N C1qtnf3 n/a
4 TRCN0000246739 CAATCAGAACAGTGGCATTAT pLKO_005 703 CDS 100% 13.200 9.240 N C1qtnf3 n/a
5 TRCN0000216761 GATGTCATGACTGGGAGATTT pLKO.1 761 CDS 100% 13.200 9.240 N C1qtnf3 n/a
6 TRCN0000257548 TTGCCTGTGTCAAGATGAATA pLKO_005 154 CDS 100% 13.200 9.240 N C1qtnf3 n/a
7 TRCN0000179273 GCAATCAGAACAGTGGCATTA pLKO.1 702 CDS 100% 10.800 7.560 N C1qtnf3 n/a
8 TRCN0000143629 GCCTGTGTCAAGATGAATACA pLKO.1 156 CDS 100% 5.625 3.938 N C1QTNF3 n/a
9 TRCN0000183445 GCTGATATAGTACAGAAGTTA pLKO.1 1928 3UTR 100% 5.625 3.938 N C1qtnf3 n/a
10 TRCN0000142890 CAACACAGTCTTCAGCATGTA pLKO.1 874 CDS 100% 4.950 3.465 N C1QTNF3 n/a
11 TRCN0000257556 AGTGTTGCCATGGAGATTATG pLKO_005 438 CDS 100% 13.200 7.920 N C1qtnf3 n/a
12 TRCN0000142944 CCAGGAAACCATGGAAACAAT pLKO.1 509 CDS 100% 5.625 3.375 N C1QTNF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04667 pDONR223 100% 90.9% 93.1% None (many diffs) n/a
2 ccsbBroad304_04667 pLX_304 0% 90.9% 93.1% V5 (many diffs) n/a
3 TRCN0000468020 CCTTCGTACCCTAACCATAAATCC pLX_317 37.8% 90.9% 93.1% V5 (many diffs) n/a
4 ccsbBroadEn_13044 pDONR223 100% 36.3% 38.8% None (many diffs) n/a
5 ccsbBroad304_13044 pLX_304 0% 36.3% 38.8% V5 (many diffs) n/a
6 TRCN0000468749 CTACTTATAAACTAGTATTAAAAT pLX_317 100% 36.3% 38.8% V5 (many diffs) n/a
Download CSV