Transcript: Human NM_181435.6

Homo sapiens C1q and TNF related 3 (C1QTNF3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
C1QTNF3 (114899)
Length:
3773
CDS:
89..1048

Additional Resources:

NCBI RefSeq record:
NM_181435.6
NBCI Gene record:
C1QTNF3 (114899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181435.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371523 GCTGCCTTATTAGCTAATTTA pLKO_005 1503 3UTR 100% 15.000 21.000 N C1QTNF3 n/a
2 TRCN0000371462 TCAGATGACCTTGACTAATAT pLKO_005 1247 3UTR 100% 15.000 10.500 N C1QTNF3 n/a
3 TRCN0000257548 TTGCCTGTGTCAAGATGAATA pLKO_005 145 CDS 100% 13.200 9.240 N C1qtnf3 n/a
4 TRCN0000143629 GCCTGTGTCAAGATGAATACA pLKO.1 147 CDS 100% 5.625 3.938 N C1QTNF3 n/a
5 TRCN0000257572 GAAGTGTATGTGTACCTTATG pLKO_005 836 CDS 100% 10.800 5.400 Y C1qtnf3 n/a
6 TRCN0000371572 GAAGTGTATGTGTACCTTATG pLKO_005 836 CDS 100% 10.800 5.400 Y C1QTNF3 n/a
7 TRCN0000142944 CCAGGAAACCATGGAAACAAT pLKO.1 500 CDS 100% 5.625 2.813 Y C1QTNF3 n/a
8 TRCN0000142890 CAACACAGTCTTCAGCATGTA pLKO.1 865 CDS 100% 4.950 2.475 Y C1QTNF3 n/a
9 TRCN0000139029 CATGGAGACTACAGCTTTCGA pLKO.1 437 CDS 100% 3.000 1.500 Y C1QTNF3 n/a
10 TRCN0000143783 GTAAGTGTTGTCATGGAGACT pLKO.1 426 CDS 100% 2.640 1.320 Y C1QTNF3 n/a
11 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 2742 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
12 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 2542 3UTR 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181435.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04667 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04667 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468020 CCTTCGTACCCTAACCATAAATCC pLX_317 37.8% 100% 100% V5 n/a
4 ccsbBroadEn_13044 pDONR223 100% 39.3% 39.1% None 1_579del;859A>G n/a
5 ccsbBroad304_13044 pLX_304 0% 39.3% 39.1% V5 1_579del;859A>G n/a
6 TRCN0000468749 CTACTTATAAACTAGTATTAAAAT pLX_317 100% 39.3% 39.1% V5 1_579del;859A>G n/a
Download CSV