Transcript: Human NR_037951.1

Homo sapiens C1QTNF3-AMACR readthrough (NMD candidate) (C1QTNF3-AMACR), long non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
C1QTNF3-AMACR (100534612)
Length:
3612
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037951.1
NBCI Gene record:
C1QTNF3-AMACR (100534612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431801 ACTTTGGGTACTTATACTAAA pLKO_005 1705 3UTR 100% 13.200 6.600 Y AMACR n/a
2 TRCN0000084113 CCACAAATTGTATGGTGATAA pLKO.1 1894 3UTR 100% 13.200 6.600 Y AMACR n/a
3 TRCN0000084116 CGAAGAGATTTATCAGCTTAA pLKO.1 1439 3UTR 100% 10.800 5.400 Y AMACR n/a
4 TRCN0000257572 GAAGTGTATGTGTACCTTATG pLKO_005 556 3UTR 100% 10.800 5.400 Y C1qtnf3 n/a
5 TRCN0000371572 GAAGTGTATGTGTACCTTATG pLKO_005 556 3UTR 100% 10.800 5.400 Y C1QTNF3 n/a
6 TRCN0000422956 GCACCTTTCTATACGACTTAC pLKO_005 1005 3UTR 100% 10.800 5.400 Y AMACR n/a
7 TRCN0000419430 GTAGAGTAACACATAACATTG pLKO_005 1552 3UTR 100% 10.800 5.400 Y AMACR n/a
8 TRCN0000142944 CCAGGAAACCATGGAAACAAT pLKO.1 220 3UTR 100% 5.625 2.813 Y C1QTNF3 n/a
9 TRCN0000084114 CTGAGGAGATACTTGAAGAAT pLKO.1 1405 3UTR 100% 5.625 2.813 Y AMACR n/a
10 TRCN0000142890 CAACACAGTCTTCAGCATGTA pLKO.1 585 3UTR 100% 4.950 2.475 Y C1QTNF3 n/a
11 TRCN0000139029 CATGGAGACTACAGCTTTCGA pLKO.1 157 3UTR 100% 3.000 1.500 Y C1QTNF3 n/a
12 TRCN0000143783 GTAAGTGTTGTCATGGAGACT pLKO.1 146 3UTR 100% 2.640 1.320 Y C1QTNF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04667 pDONR223 100% 19.2% None (many diffs) n/a
2 ccsbBroad304_04667 pLX_304 0% 19.2% V5 (many diffs) n/a
3 TRCN0000468020 CCTTCGTACCCTAACCATAAATCC pLX_317 37.8% 19.2% V5 (many diffs) n/a
4 ccsbBroadEn_07914 pDONR223 100% 14.3% None (many diffs) n/a
5 ccsbBroad304_07914 pLX_304 0% 14.3% V5 (many diffs) n/a
6 TRCN0000480210 ATAATCTTTCTGTGCCAGACATGT pLX_317 66.6% 14.3% V5 (many diffs) n/a
7 ccsbBroadEn_13044 pDONR223 100% 10.4% None 1_387del;667A>G;766_3612del n/a
8 ccsbBroad304_13044 pLX_304 0% 10.4% V5 1_387del;667A>G;766_3612del n/a
9 TRCN0000468749 CTACTTATAAACTAGTATTAAAAT pLX_317 100% 10.4% V5 1_387del;667A>G;766_3612del n/a
Download CSV