Construct: ORF TRCN0000468024
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011840.3_s317c1
- Derived from:
- ccsbBroadEn_10976
- DNA Barcode:
- TGCACTCTTTGTACGATAGCTGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPP2 (4355)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468024
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4355 | MPP2 | membrane palmitoylated prot... | NM_001278381.1 | 99.8% | 100% | 381A>G;525A>G |
2 | human | 4355 | MPP2 | membrane palmitoylated prot... | NM_005374.5 | 99.8% | 100% | 381A>G;525A>G |
3 | human | 4355 | MPP2 | membrane palmitoylated prot... | XM_024450761.1 | 99.8% | 100% | 381A>G;525A>G |
4 | human | 4355 | MPP2 | membrane palmitoylated prot... | XM_024450762.1 | 99.8% | 100% | 381A>G;525A>G |
5 | human | 4355 | MPP2 | membrane palmitoylated prot... | XM_024450763.1 | 99.8% | 100% | 381A>G;525A>G |
6 | human | 4355 | MPP2 | membrane palmitoylated prot... | NM_001278371.1 | 97.8% | 98% | 0_1ins33;348A>G;492A>G |
7 | human | 4355 | MPP2 | membrane palmitoylated prot... | NM_001278373.2 | 97.8% | 98% | 0_1ins33;348A>G;492A>G |
8 | human | 4355 | MPP2 | membrane palmitoylated prot... | NM_001278375.1 | 97.8% | 98% | 0_1ins33;348A>G;492A>G |
9 | human | 4355 | MPP2 | membrane palmitoylated prot... | NM_001278372.2 | 95.7% | 95.8% | 150_221del;453A>G;597A>G |
10 | human | 4355 | MPP2 | membrane palmitoylated prot... | NM_001278376.3 | 95.5% | 95.6% | (many diffs) |
11 | human | 4355 | MPP2 | membrane palmitoylated prot... | NM_001278370.1 | 92.3% | 92.4% | 1_135del;516A>G;660A>G |
12 | human | 4355 | MPP2 | membrane palmitoylated prot... | XM_024450760.1 | 90.9% | 91% | 1_162del;543A>G;687A>G |
13 | human | 4355 | MPP2 | membrane palmitoylated prot... | XM_011524827.2 | 87.5% | 87.6% | (many diffs) |
14 | human | 4355 | MPP2 | membrane palmitoylated prot... | NM_001278374.2 | 74.7% | 74.8% | 0_1ins417;108A>G |
15 | human | 4355 | MPP2 | membrane palmitoylated prot... | XR_001752510.2 | 38.7% | (many diffs) | |
16 | human | 4355 | MPP2 | membrane palmitoylated prot... | XR_002958008.1 | 37.8% | (many diffs) | |
17 | human | 4355 | MPP2 | membrane palmitoylated prot... | XR_001752511.2 | 37.4% | (many diffs) | |
18 | mouse | 50997 | Mpp2 | membrane protein, palmitoyl... | NM_016695.3 | 89.7% | 97.6% | (many diffs) |
19 | mouse | 50997 | Mpp2 | membrane protein, palmitoyl... | XM_006533684.3 | 89.7% | 97.6% | (many diffs) |
20 | mouse | 50997 | Mpp2 | membrane protein, palmitoyl... | XM_006533685.3 | 89.7% | 97.6% | (many diffs) |
21 | mouse | 50997 | Mpp2 | membrane protein, palmitoyl... | XM_006533683.3 | 86.4% | 93.4% | (many diffs) |
22 | mouse | 50997 | Mpp2 | membrane protein, palmitoyl... | XM_006533687.1 | 67.4% | 73.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1722
- ORF length:
- 1656
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ggttgccgcc accaactctg aaactgccat gcagcaagtc ctggacaact 121 tgggatccct ccccagtgcc acgggggctg cagagctgga cctgatcttc cttcgaggca 181 ttatggaaag tcccatagta agatccctgg ccaaggccca tgagaggctg gaggagacga 241 agctggaggc cgtgagagac aacaacctgg agctggtgca ggagatcctg cgggacctgg 301 cgcagctggc tgagcagagc agcacagccg ccgagctggc ccacatcctc caggagcccc 361 acttccagtc cctcctggag acgcacgact ctgtggcctc aaagacctat gagacaccac 421 cccccagccc tggcctggac cctacgttca gcaaccagcc tgtacctccc gatgctgtgc 481 gcatggtggg catccgcaag acagccggag aacatctggg tgtaacgttc cgcgtggagg 541 gcggcgagct ggtgatcgcg cgcattctgc atgggggcat ggtggctcag caaggcctgc 601 tgcatgtggg tgacatcatc aaggaggtga acgggcagcc agtgggcagt gacccccgcg 661 cactgcagga gctcctgcgc aatgccagtg gcagtgtcat cctcaagatc ctgcccagct 721 accaggagcc ccatctgccc cgccaggtat ttgtgaaatg tcactttgac tatgacccgg 781 cccgagacag cctcatcccc tgcaaggaag caggcctgcg cttcaacgcc ggggacttgc 841 tccagatcgt aaaccaggat gatgccaact ggtggcaggc atgccatgtc gaagggggca 901 gtgctgggct cattcccagc cagctgctgg aggagaagcg gaaagcattt gtcaagaggg 961 acctggagct gacaccaaac tcagggaccc tatgcggcag cctttcagga aagaaaaaga 1021 agcgaatgat gtatttgacc accaagaatg cagagtttga ccgtcatgag ctgctcattt 1081 atgaggaggt ggcccgcatg cccccgttcc gccggaaaac cctggtactg attggggctc 1141 agggcgtggg acggcgcagc ctgaagaaca agctcatcat gtgggatcca gatcgctatg 1201 gcaccacggt gccctacacc tcccggcggc cgaaagactc agagcgggaa ggtcagggtt 1261 acagctttgt gtcccgtggG GAGATGGAGG CTGACGTCCG TGCTGGGCGC TACCTGGAGC 1321 ATGGCGAATA CGAGGGCAAC CTGTATGGCA CACGTATTGA CTCCATCCGG GGCGTGGTCG 1381 CTGCTGGGAA GGTGTGCGTG CTGGATGTCA ACCCCCAGGC GGTGAAGGTG CTACGAACGG 1441 CCGAGTTTGT CCCTTACGTG GTGTTCATCG AGGCCCCAGA CTTCGAGACC CTGCGGGCCA 1501 TGAACAGGGC TGCGCTGGAG AGTGGAATAT CCACCAAGCA GCTCACGGAG GCGGACCTGA 1561 GACGGACAGT GGAGGAGAGC AGCCGCATCC AGCGGGGCTA CGGGCACTAC TTTGACCTCT 1621 GCCTGGTCAA TAGCAACCTG GAGAGGACCT TCCGCGAGCT CCAGACAGCC ATGGAGAAGC 1681 TACGGACAGA GCCCCAGTGG GTGCCTGTCA GCTGGGTGTA CTGCCCAACT TTCTTGTACA 1741 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1801 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1861 AGGACGATGC ACTCTTTGTA CGATAGCTGC GACGCGTTAA GTCgacaatc aacctctgga 1921 ttacaaaatt tgtgaaagat t