Transcript: Human XR_001752510.2

PREDICTED: Homo sapiens membrane palmitoylated protein 2 (MPP2), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPP2 (4355)
Length:
4268
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752510.2
NBCI Gene record:
MPP2 (4355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234652 GGACTTGCTCCAGATCGTAAA pLKO_005 895 3UTR 100% 10.800 15.120 N MPP2 n/a
2 TRCN0000006128 CAGATCGTAAACCAGGATGAT pLKO.1 905 3UTR 100% 4.950 3.960 N MPP2 n/a
3 TRCN0000006127 CCCGCCAGGTATTTGTGAAAT pLKO.1 801 3UTR 100% 13.200 9.240 N MPP2 n/a
4 TRCN0000234653 CCGTCATGAGCTGCTCATTTA pLKO_005 1155 3UTR 100% 13.200 9.240 N MPP2 n/a
5 TRCN0000234651 GATCTTCCTTCGAGGCATTAT pLKO_005 226 3UTR 100% 13.200 9.240 N MPP2 n/a
6 TRCN0000234654 CTACCTGGAGCATGGCGAATA pLKO_005 1404 3UTR 100% 10.800 7.560 N MPP2 n/a
7 TRCN0000234655 GTTGGTGTGGCTCTGCGTATA pLKO_005 3554 3UTR 100% 10.800 7.560 N MPP2 n/a
8 TRCN0000006130 CAACCTGTATGGCACACGTAT pLKO.1 1431 3UTR 100% 4.950 3.465 N MPP2 n/a
9 TRCN0000006126 CCACAGCTCTATGACTCTGTT pLKO.1 4056 3UTR 100% 4.950 3.465 N MPP2 n/a
10 TRCN0000006129 CTGATCTTCCTTCGAGGCATT pLKO.1 224 3UTR 100% 4.050 2.835 N MPP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10976 pDONR223 100% 38.7% None (many diffs) n/a
2 ccsbBroad304_10976 pLX_304 0% 38.7% V5 (many diffs) n/a
3 TRCN0000468024 TGCACTCTTTGTACGATAGCTGCG pLX_317 27% 38.7% V5 (many diffs) n/a
4 ccsbBroadEn_14701 pDONR223 0% 38.7% None (many diffs) n/a
5 ccsbBroad304_14701 pLX_304 0% 38.7% V5 (many diffs) n/a
6 TRCN0000471395 GCTCCGGCGTTTTTCGCGCTAATT pLX_317 27.3% 38.7% V5 (many diffs) n/a
Download CSV