Transcript: Mouse XM_006533684.3

PREDICTED: Mus musculus membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) (Mpp2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mpp2 (50997)
Length:
4349
CDS:
390..2048

Additional Resources:

NCBI RefSeq record:
XM_006533684.3
NBCI Gene record:
Mpp2 (50997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533684.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274690 GATCTTTCTTCGAGGCATAAT pLKO_005 488 CDS 100% 13.200 18.480 N Mpp2 n/a
2 TRCN0000274689 ACCTAGAACATGGCGAGTATG pLKO_005 1636 CDS 100% 10.800 15.120 N Mpp2 n/a
3 TRCN0000024274 CCCGACAGGTATTTGTTAAAT pLKO.1 1063 CDS 100% 15.000 12.000 N Mpp2 n/a
4 TRCN0000024275 CGCCATGAGCTGCTCATTTAT pLKO.1 1386 CDS 100% 15.000 10.500 N Mpp2 n/a
5 TRCN0000274749 CTAGGCAGACCCAGGTAATAG pLKO_005 2522 3UTR 100% 13.200 9.240 N Mpp2 n/a
6 TRCN0000274748 GAACACCTGGGTGTGACATTC pLKO_005 834 CDS 100% 10.800 7.560 N Mpp2 n/a
7 TRCN0000024278 CTCCAGATTGTAAACCAAGAT pLKO.1 1164 CDS 100% 4.950 3.465 N Mpp2 n/a
8 TRCN0000274688 CTCCAGATTGTAAACCAAGAT pLKO_005 1164 CDS 100% 4.950 3.465 N Mpp2 n/a
9 TRCN0000024277 GTGTTCATAGAGGCTCCTGAT pLKO.1 1785 CDS 100% 4.050 2.835 N Mpp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533684.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10976 pDONR223 100% 89.7% 97.6% None (many diffs) n/a
2 ccsbBroad304_10976 pLX_304 0% 89.7% 97.6% V5 (many diffs) n/a
3 TRCN0000468024 TGCACTCTTTGTACGATAGCTGCG pLX_317 27% 89.7% 97.6% V5 (many diffs) n/a
4 ccsbBroadEn_14701 pDONR223 0% 89.7% 97.6% None (many diffs) n/a
5 ccsbBroad304_14701 pLX_304 0% 89.7% 97.6% V5 (many diffs) n/a
6 TRCN0000471395 GCTCCGGCGTTTTTCGCGCTAATT pLX_317 27.3% 89.7% 97.6% V5 (many diffs) n/a
Download CSV