Transcript: Human NM_005374.5

Homo sapiens membrane palmitoylated protein 2 (MPP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
MPP2 (4355)
Length:
4202
CDS:
97..1755

Additional Resources:

NCBI RefSeq record:
NM_005374.5
NBCI Gene record:
MPP2 (4355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148423 TTGGCCAGGGATCTTACTAT pXPR_003 GGG 132 8% 3 0.5312 MPP2 MPP2 77807
2 BRDN0001147604 CCAGGGTGTAACGTTCCGCG pXPR_003 TGG 466 28% 6 0.3597 MPP2 MPP2 77808
3 BRDN0001147770 TTAGGCATGCCATGTCGAAG pXPR_003 GGG 826 50% 8 0.0468 MPP2 MPP2 77809
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005374.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234652 GGACTTGCTCCAGATCGTAAA pLKO_005 864 CDS 100% 10.800 15.120 N MPP2 n/a
2 TRCN0000006128 CAGATCGTAAACCAGGATGAT pLKO.1 874 CDS 100% 4.950 3.960 N MPP2 n/a
3 TRCN0000006127 CCCGCCAGGTATTTGTGAAAT pLKO.1 770 CDS 100% 13.200 9.240 N MPP2 n/a
4 TRCN0000234653 CCGTCATGAGCTGCTCATTTA pLKO_005 1092 CDS 100% 13.200 9.240 N MPP2 n/a
5 TRCN0000234651 GATCTTCCTTCGAGGCATTAT pLKO_005 195 CDS 100% 13.200 9.240 N MPP2 n/a
6 TRCN0000234654 CTACCTGGAGCATGGCGAATA pLKO_005 1341 CDS 100% 10.800 7.560 N MPP2 n/a
7 TRCN0000234655 GTTGGTGTGGCTCTGCGTATA pLKO_005 3491 3UTR 100% 10.800 7.560 N MPP2 n/a
8 TRCN0000006130 CAACCTGTATGGCACACGTAT pLKO.1 1368 CDS 100% 4.950 3.465 N MPP2 n/a
9 TRCN0000006126 CCACAGCTCTATGACTCTGTT pLKO.1 3993 3UTR 100% 4.950 3.465 N MPP2 n/a
10 TRCN0000006129 CTGATCTTCCTTCGAGGCATT pLKO.1 193 CDS 100% 4.050 2.835 N MPP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005374.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10976 pDONR223 100% 99.8% 100% None 381A>G;525A>G n/a
2 ccsbBroad304_10976 pLX_304 0% 99.8% 100% V5 381A>G;525A>G n/a
3 TRCN0000468024 TGCACTCTTTGTACGATAGCTGCG pLX_317 27% 99.8% 100% V5 381A>G;525A>G n/a
4 ccsbBroadEn_14701 pDONR223 0% 99.8% 100% None 381A>G;525A>G n/a
5 ccsbBroad304_14701 pLX_304 0% 99.8% 100% V5 381A>G;525A>G n/a
6 TRCN0000471395 GCTCCGGCGTTTTTCGCGCTAATT pLX_317 27.3% 99.8% 100% V5 381A>G;525A>G n/a
Download CSV