Construct: ORF TRCN0000468140
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008673.1_s317c1
- Derived from:
- ccsbBroadEn_07947
- DNA Barcode:
- CCTAGATTGTGCATGTAGGAACAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TNFAIP8 (25816)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468140
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 25816 | TNFAIP8 | TNF alpha induced protein 8 | NM_001286813.2 | 99.4% | 99.4% | 156T>C;226A>G;474G>C |
| 2 | human | 25816 | TNFAIP8 | TNF alpha induced protein 8 | NM_014350.4 | 99.4% | 99.4% | 156T>C;226A>G;474G>C |
| 3 | human | 25816 | TNFAIP8 | TNF alpha induced protein 8 | XM_017009327.1 | 95.5% | 94% | (many diffs) |
| 4 | human | 25816 | TNFAIP8 | TNF alpha induced protein 8 | NM_001077654.3 | 94.2% | 93.9% | (many diffs) |
| 5 | human | 25816 | TNFAIP8 | TNF alpha induced protein 8 | NM_001286814.1 | 91.6% | 90% | (many diffs) |
| 6 | human | 25816 | TNFAIP8 | TNF alpha induced protein 8 | NM_001286815.2 | 83.3% | 83.3% | (many diffs) |
| 7 | human | 25816 | TNFAIP8 | TNF alpha induced protein 8 | NM_001286817.2 | 83.3% | 83.3% | (many diffs) |
| 8 | human | 25816 | TNFAIP8 | TNF alpha induced protein 8 | XM_017009328.1 | 83.3% | 83.3% | (many diffs) |
| 9 | mouse | 106869 | Tnfaip8 | tumor necrosis factor, alph... | XM_006525479.2 | 83.1% | 89.3% | (many diffs) |
| 10 | mouse | 106869 | Tnfaip8 | tumor necrosis factor, alph... | XM_006525480.1 | 82.6% | 89.3% | (many diffs) |
| 11 | mouse | 106869 | Tnfaip8 | tumor necrosis factor, alph... | NM_001177759.1 | 81.4% | 88.8% | (many diffs) |
| 12 | mouse | 106869 | Tnfaip8 | tumor necrosis factor, alph... | NM_134131.2 | 80% | 86.7% | (many diffs) |
| 13 | mouse | 106869 | Tnfaip8 | tumor necrosis factor, alph... | XM_011246795.2 | 80% | 86.7% | (many diffs) |
| 14 | mouse | 106869 | Tnfaip8 | tumor necrosis factor, alph... | XM_011246796.2 | 80% | 86.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 660
- ORF length:
- 594
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ctccgaagca gaagaatcca aggaagtggc cacagatgtc tttaattcca 121 aaaacctggc cgttcaggca caaaagaaga tcttgggtaa aatggtgtcc aaatccatcg 181 ccaccacctt aatagacgac acaagtagtg aggtgctgga cgagctctac agagtgacca 241 gggagtacac ccaaaacaag aaggaggcag agaagatcat caagaacctc gtcaagacag 301 tcatcaagct ggccattctt tataggaata atcagtttaa tcaagatgag ctagcattga 361 tggagaaatT TAAGAAGAAA GTTCATCAGC TTGCTATGAC CGTGGTCAGT TTCCATCAGG 421 TGGATTATAC CTTTGACCGG AATGTGTTAT CCAGGCTGTT AAATGAATGC AGAGAGATGC 481 TGCACCAAAT CATTCAGCGC CACCTCACTG CCAAGTCACA TGGACGGGTT AATAATGTCT 541 TTGATCATTT TTCAGATTGT GAATTTTTGG CTGCCTTGTA TAATCCTTTT GGGAATTTTA 601 AACCCCACTT ACAAAAACTA TGTGATGGTA TCAACAAAAT GTTGGATGAA GAGAACATAT 661 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 721 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 781 TTTATATATC TTGTGGAAAG GACGACCTAG ATTGTGCATG TAGGAACAAA CGCGTTAAGT 841 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt