Construct: ORF TRCN0000468167
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013498.1_s317c1
- Derived from:
- ccsbBroadEn_10468
- DNA Barcode:
- GAGTAAGCCTTTATCTGTTGCCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRRTM4 (80059)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468167
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 80059 | LRRTM4 | leucine rich repeat transme... | NM_001282928.3 | 100% | 100% | |
| 2 | human | 80059 | LRRTM4 | leucine rich repeat transme... | NM_024993.6 | 99.8% | 99.6% | 3_4insCCA |
| 3 | human | 80059 | LRRTM4 | leucine rich repeat transme... | NM_001330370.1 | 87.7% | 87.6% | 1555A>G;1557_1773delinsA |
| 4 | human | 80059 | LRRTM4 | leucine rich repeat transme... | NM_001134745.2 | 87.5% | 87.3% | 3_4insCCA;1552A>G;1554_1770delinsA |
| 5 | human | 80059 | LRRTM4 | leucine rich repeat transme... | NM_001282924.2 | 87.5% | 87.3% | 3_4insCCA;1552A>G;1554_1770delinsA |
| 6 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | NM_001282102.1 | 88.5% | 95.7% | (many diffs) |
| 7 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_006506089.3 | 88.5% | 95.7% | (many diffs) |
| 8 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_011241336.2 | 88.4% | 95.5% | (many diffs) |
| 9 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | NM_178731.5 | 88.3% | 95.3% | (many diffs) |
| 10 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_006506088.2 | 84.8% | 91.6% | (many diffs) |
| 11 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | NM_001134743.1 | 77.7% | 83.9% | (many diffs) |
| 12 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | NM_001347261.1 | 77.5% | 83.5% | (many diffs) |
| 13 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_006506085.1 | 77.5% | 83.5% | (many diffs) |
| 14 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_006506086.2 | 77.5% | 83.5% | (many diffs) |
| 15 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_006506087.2 | 77.5% | 83.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1626
- ORF length:
- 1557
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccaggtttc catttaatta cgcagctgaa aggcatgagt gtggtgctgg 121 tgctacttcc tacactgctg cttgttatgc tcacgggtgc tcagagagct tgcccaaaga 181 actgcagatg tgatggcaaa attgtgtact gtgagtctca tgctttcgca gatatccctg 241 agaacatttc tggagggtca caaggcttat cattaaggtt caacagcatt cagaagctca 301 aatccaatca gtttgccggc cttaaccagc ttatatggct ttatcttgac cataattaca 361 ttagctcagt ggatgaagat gcatttcaag ggatccgtag actgaaagaa ttaattctaa 421 gctccaacaa aattacttat ctgcacaata aaacatttca cccagttccc aatctccgca 481 atctggacct ctcctacaat aagcttcaga cattgcaatc tgaacaattt aaaggccttc 541 ggaaactcat cattttgcac ttgagatcta actcactaaa gactgtgccc ataagagttt 601 ttcaagactg tcggaatctt gattttttgg atttgggtta caatcgtctt cgaagcttgt 661 cccgaaatgc atttgctggc ctcttgaagt taaaggagct ccacctggag cacaaccagt 721 tttccaagat caactttgct cattttccac gtctcttcaa cctccgctca atttacttac 781 aatggaacag gattcgctcc attagccaag gtttgacatg gacttggagt tccttacaca 841 acttggattt atcagggaat gacatccaag gaattgagcc gggcacattt aaatgcctcc 901 ccaatttaca aaaattgaat ttggattcca acaagctcac caatatctca caggaaactg 961 tcaatgcgtg gatatcatta atatccatca cattgtctgg aaatatgtgg gaatgcagtc 1021 ggagcatttg tcctttattt tattggctta agaatttcaa aggaaataag gaaagcacca 1081 tgatatgtgc gggacctaag cacatccagg gtgaaaaggt tagtgatgca gtggaaacat 1141 ataatatctg ttctgaagtc caggtggtca acacagaaag atcacacctg gtgccccaaa 1201 ctccccagaa accTCTGATT ATCCCTAGAC CTACCATCTT CAAACCTGAC GTCACCCAAT 1261 CCACCTTTGA AACACCAAGC CCTTCCCCAG GGTTTCAGAT TCCTGGCGCA GAGCAAGAGT 1321 ATGAGCATGT TTCATTTCAC AAAATTATTG CCGGGAGTGT GGCTCTCTTT CTCTCAGTGG 1381 CCATGATCCT CTTGGTGATC TATGTGTCTT GGAAACGCTA CCCAGCCAGC ATGAAACAAC 1441 TCCAGCAACA CTCTCTTATG AAGAGGCGGC GGAAAAAGGC CAGAGAGTCT GAAAGACAAA 1501 TGAATTCCCC TTTACAGGAG TATTATGTGG ACTACAAGCC TACAAACTCT GAGACCATGG 1561 ATATATCGGT TAATGGATCT GGGCCCTGCA CATATACCAT CTCTGGCTCC AGGGAATGTG 1621 AGGTATTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1681 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1741 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGAGTAAGCC TTTATCTGTT GCCACACGCG 1801 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt