Transcript: Human NM_024993.6

Homo sapiens leucine rich repeat transmembrane neuronal 4 (LRRTM4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
LRRTM4 (80059)
Length:
3626
CDS:
416..1972

Additional Resources:

NCBI RefSeq record:
NM_024993.6
NBCI Gene record:
LRRTM4 (80059)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024993.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217133 CCATGGATATATCGGTTAATG pLKO.1 1899 CDS 100% 13.200 18.480 N Lrrtm4 n/a
2 TRCN0000147168 CCTCAAATAAAGGTGTACCTT pLKO.1 2976 3UTR 100% 3.000 2.400 N LRRTM4 n/a
3 TRCN0000129757 CGGAGCATTTGTCCTTTATTT pLKO.1 1364 CDS 100% 15.000 10.500 N LRRTM4 n/a
4 TRCN0000250010 GGCTTTATCTTGACCATAATT pLKO_005 681 CDS 100% 15.000 10.500 N Lrrtm4 n/a
5 TRCN0000257992 ACCATGGATATATCGGTTAAT pLKO_005 1898 CDS 100% 13.200 9.240 N Lrrtm4 n/a
6 TRCN0000149399 GCCTTCGGAAACTCATCATTT pLKO.1 879 CDS 100% 13.200 9.240 N LRRTM4 n/a
7 TRCN0000129103 CCTTTCTGTAACAGCCTCAAA pLKO.1 2962 3UTR 100% 4.950 3.465 N LRRTM4 n/a
8 TRCN0000149145 GAGCAAGAGTATGAGCATGTT pLKO.1 1655 CDS 100% 4.950 3.465 N LRRTM4 n/a
9 TRCN0000127934 CCCTTTCTGTAACAGCCTCAA pLKO.1 2961 3UTR 100% 4.050 2.835 N LRRTM4 n/a
10 TRCN0000127818 GCCAAGGTTTGACATGGACTT pLKO.1 1149 CDS 100% 4.050 2.835 N LRRTM4 n/a
11 TRCN0000149577 GATTCCAACAAGCTCACCAAT pLKO.1 1268 CDS 100% 4.950 2.970 N LRRTM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024993.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10468 pDONR223 100% 99.8% 99.6% None 3_4insCCA n/a
2 ccsbBroad304_10468 pLX_304 0% 99.8% 99.6% V5 3_4insCCA n/a
3 TRCN0000468167 GAGTAAGCCTTTATCTGTTGCCAC pLX_317 26.7% 99.8% 99.6% V5 3_4insCCA n/a
4 ccsbBroadEn_12667 pDONR223 100% 39.9% 39.9% None 1_933del n/a
5 ccsbBroad304_12667 pLX_304 0% 39.9% 39.9% V5 1_933del n/a
6 TRCN0000472281 GACTAAAAACAGGACTTTACAAGA pLX_317 55.2% 39.9% 39.9% V5 1_933del n/a
Download CSV