Transcript: Mouse XM_006506086.2

PREDICTED: Mus musculus leucine rich repeat transmembrane neuronal 4 (Lrrtm4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrtm4 (243499)
Length:
3154
CDS:
409..2181

Additional Resources:

NCBI RefSeq record:
XM_006506086.2
NBCI Gene record:
Lrrtm4 (243499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257992 ACCATGGATATATCGGTTAAT pLKO_005 1891 CDS 100% 13.200 18.480 N Lrrtm4 n/a
2 TRCN0000217133 CCATGGATATATCGGTTAATG pLKO.1 1892 CDS 100% 13.200 10.560 N Lrrtm4 n/a
3 TRCN0000188270 CCTACCATCTTCAAACCGGAT pLKO.1 1567 CDS 100% 2.160 1.728 N Lrrtm4 n/a
4 TRCN0000250009 ATTACCTATCTGCACAATAAA pLKO_005 769 CDS 100% 15.000 10.500 N Lrrtm4 n/a
5 TRCN0000217849 CCTTGCACACCTTGGATTTAT pLKO.1 1169 CDS 100% 15.000 10.500 N Lrrtm4 n/a
6 TRCN0000250010 GGCTTTATCTTGACCATAATT pLKO_005 674 CDS 100% 15.000 10.500 N Lrrtm4 n/a
7 TRCN0000149577 GATTCCAACAAGCTCACCAAT pLKO.1 1261 CDS 100% 4.950 3.465 N LRRTM4 n/a
8 TRCN0000187545 GTCAACACAGAACGATCACAT pLKO.1 1504 CDS 100% 4.950 3.465 N Lrrtm4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10468 pDONR223 100% 77.5% 83.5% None (many diffs) n/a
2 ccsbBroad304_10468 pLX_304 0% 77.5% 83.5% V5 (many diffs) n/a
3 TRCN0000468167 GAGTAAGCCTTTATCTGTTGCCAC pLX_317 26.7% 77.5% 83.5% V5 (many diffs) n/a
4 ccsbBroadEn_12667 pDONR223 100% 30.1% 32.3% None (many diffs) n/a
5 ccsbBroad304_12667 pLX_304 0% 30.1% 32.3% V5 (many diffs) n/a
6 TRCN0000472281 GACTAAAAACAGGACTTTACAAGA pLX_317 55.2% 30.1% 32.3% V5 (many diffs) n/a
Download CSV