Construct: ORF TRCN0000468458
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018864.3_s317c1
- Derived from:
- ccsbBroadEn_14583
- DNA Barcode:
- GCTCCATCGTAGTTTCAGGTTTAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- CHKA (1119)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468458
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1119 | CHKA | choline kinase alpha | XM_017017148.2 | 77.4% | 6.9% | (many diffs) |
| 2 | human | 1119 | CHKA | choline kinase alpha | NM_001277.3 | 76.9% | 20.9% | (many diffs) |
| 3 | human | 1119 | CHKA | choline kinase alpha | NM_212469.1 | 73% | 17% | (many diffs) |
| 4 | human | 1119 | CHKA | choline kinase alpha | XM_017017147.1 | 68.8% | 18.5% | (many diffs) |
| 5 | human | 1119 | CHKA | choline kinase alpha | XR_428904.3 | 53.2% | (many diffs) | |
| 6 | human | 1119 | CHKA | choline kinase alpha | XR_949772.2 | 34.3% | (many diffs) | |
| 7 | human | 1119 | CHKA | choline kinase alpha | XR_949773.2 | 32.1% | (many diffs) | |
| 8 | human | 1119 | CHKA | choline kinase alpha | XR_428905.3 | 11.8% | (many diffs) | |
| 9 | mouse | 12660 | Chka | choline kinase alpha | NM_001271496.1 | 68% | 20.9% | (many diffs) |
| 10 | mouse | 12660 | Chka | choline kinase alpha | XM_006531648.2 | 67% | 6.6% | (many diffs) |
| 11 | mouse | 12660 | Chka | choline kinase alpha | XM_006531649.2 | 67% | 6.6% | (many diffs) |
| 12 | mouse | 12660 | Chka | choline kinase alpha | XM_006531650.2 | 67% | 6.6% | (many diffs) |
| 13 | mouse | 12660 | Chka | choline kinase alpha | XM_006531651.3 | 67% | 6.6% | (many diffs) |
| 14 | mouse | 12660 | Chka | choline kinase alpha | XM_011248599.2 | 67% | 6.6% | (many diffs) |
| 15 | mouse | 12660 | Chka | choline kinase alpha | XM_011248600.2 | 67% | 6.6% | (many diffs) |
| 16 | mouse | 12660 | Chka | choline kinase alpha | XM_017318048.1 | 67% | 6.6% | (many diffs) |
| 17 | mouse | 12660 | Chka | choline kinase alpha | XM_017318049.1 | 67% | 6.6% | (many diffs) |
| 18 | mouse | 12660 | Chka | choline kinase alpha | XM_017318050.1 | 67% | 6.6% | (many diffs) |
| 19 | mouse | 12660 | Chka | choline kinase alpha | XM_006531646.1 | 66.5% | 20.4% | (many diffs) |
| 20 | mouse | 12660 | Chka | choline kinase alpha | NM_013490.4 | 64.1% | 17.1% | (many diffs) |
| 21 | mouse | 12660 | Chka | choline kinase alpha | XR_388248.2 | 40.4% | (many diffs) | |
| 22 | mouse | 12660 | Chka | choline kinase alpha | NR_073190.1 | 34.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 417
- ORF length:
- 348
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaaaaccaaa ttctgcaccg ggggcgagga cgagttccac atcagtgtca 121 tcagaggcgg ccttagcaac atgctgttcc agtgctccct acctgacacc acagccaccc 181 ttggtgatga gcctcggaaa gtgctcctgc ggctgtatgg agcgattttg cagatgaggt 241 cctgtaataa agagggatcc gaacaagctc agaaagaaaa tgaatttcaa ggggctgagg 301 ccatggttct ggagagcgtt atgtttgcca ttctcgcaga gaggtcactt ggnccaaaac 361 tntatgggca tctttcccca agggccgact ggagcagttc atcccgagcc ggcgattaga 421 tactgannaa ttaagtttgc cagatatttc tgcagaaatc gccgagaaaa tggctacatt 481 tcatggtatg aaaatgccat tcaataaggn accaaaatgg ctttttggca caatggaaaa 541 gtatctaaag gaagtgctga gaattaaatt tactgaggaa tccagaatta aaaagctcca 601 caaattgctc agttacaatc tgcccttgga actggaaaac ctgagatcat tgcttgaatc 661 tactccatct ccagttgtat tttgtcataa tgactgtcaa gaaggtaata tcttgttgct 721 ggaangccga gagaattctg aaaaacagaa actgatgctc attgatttcg aatacagcag 781 ttacanttac agggGATTCG ACATTGGAAA TCACTTCTGT GAGTGGATGT ATGATTATAG 841 CTATGAAAAA TACCCTTTTT TCAGAGCAAA CATCCGGAAG TATCCCACCA AGAAACAACA 901 GCTCCATTTT ATTTCCAGTT ACTTGCCTGC ATTCCAAAAT GACTTTGAAA ACCTCAGTAC 961 TGAAGAAAAA TCCATTATAA AAGAAGAAAT GTTGCTTGAA GTTAATAGGT TTGCCCTTGC 1021 ATCTCATTTC CTCTGGGGAC TGTGGTCCAT TGTACAAGCC AAGATTTCAT CTATTGAATT 1081 TGGGTACATG GACTACGCCC AAGCAAGGTT TGATGCCTAT TTCCACCAGA AGAGGAAGCT 1141 TGGGGTGTTG CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC 1201 TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT 1261 TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGCTCCAT CGTAGTTTCA GGTTTATACG 1321 CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt