Transcript: Human XR_949772.2

PREDICTED: Homo sapiens choline kinase alpha (CHKA), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHKA (1119)
Length:
2874
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_949772.2
NBCI Gene record:
CHKA (1119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_949772.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284353 TGATACTAAAGACGGTATTAA pLKO_005 1877 3UTR 100% 15.000 21.000 N CHKA n/a
2 TRCN0000284352 ATGGTTCTGGAGAGCGTTATG pLKO_005 669 3UTR 100% 10.800 15.120 N CHKA n/a
3 TRCN0000381454 GTGTTACTTGCAGGTACTTTG pLKO_005 2078 3UTR 100% 10.800 15.120 N CHKA n/a
4 TRCN0000220645 GCGACGTTTATTTCATCTCTT pLKO.1 1904 3UTR 100% 4.950 6.930 N CHKA n/a
5 TRCN0000271285 AGCAAGGTTTGATGCCTATTT pLKO_005 1697 3UTR 100% 13.200 10.560 N CHKA n/a
6 TRCN0000380081 GAGCAAACATCCGGAAGTATC pLKO_005 1228 3UTR 100% 10.800 8.640 N CHKA n/a
7 TRCN0000220649 GCCAAGATTTCATCTATTGAA pLKO.1 1422 3UTR 100% 5.625 4.500 N CHKA n/a
8 TRCN0000271284 TCGAATACAGCAGTTACAATT pLKO_005 1132 3UTR 100% 13.200 9.240 N CHKA n/a
9 TRCN0000271224 TGCGGCTGTATGGAGCGATTT pLKO_005 628 3UTR 100% 10.800 7.560 N CHKA n/a
10 TRCN0000196676 GCAGGTACTTTGGTTAATGTT pLKO.1 2087 3UTR 100% 5.625 3.938 N CHKA n/a
11 TRCN0000220648 GCTCCACAAATTGCTCAGTTA pLKO.1 959 3UTR 100% 4.950 3.465 N CHKA n/a
12 TRCN0000220646 GCGATTAGATACTGAAGAATT pLKO.1 776 3UTR 100% 0.000 0.000 N CHKA n/a
13 TRCN0000220647 CCAAGAAACAACAGCTCCATT pLKO.1 1252 3UTR 100% 4.950 2.970 N CHKA n/a
14 TRCN0000024604 GCCATTCAATAAGGAACCAAA pLKO.1 860 3UTR 100% 4.950 2.970 N Chka n/a
15 TRCN0000196889 GCCAGATATTTCTGCAGAAAT pLKO.1 803 3UTR 100% 1.320 0.792 N CHKA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_949772.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468458 GCTCCATCGTAGTTTCAGGTTTAT pLX_317 33% 34.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14583 pDONR223 100% 34.2% None (many diffs) n/a
3 ccsbBroad304_14583 pLX_304 0% 34.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15336 pDONR223 100% 32.6% None (many diffs) n/a
5 ccsbBroad304_15336 pLX_304 0% 32.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV