Transcript: Mouse NM_013490.4

Mus musculus choline kinase alpha (Chka), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Chka (12660)
Length:
2573
CDS:
304..1611

Additional Resources:

NCBI RefSeq record:
NM_013490.4
NBCI Gene record:
Chka (12660)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013490.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024606 GTTACTTGACTACATTCCAAA pLKO.1 1379 CDS 100% 4.950 6.930 N Chka n/a
2 TRCN0000257303 AGTTACGTTTACCAGATATTT pLKO_005 890 CDS 100% 15.000 12.000 N Chka n/a
3 TRCN0000234181 GTGAATGGATGTATGATTATA pLKO_005 1280 CDS 100% 15.000 12.000 N Chka n/a
4 TRCN0000024605 CTCTCTTACAACCTGCCTCTT pLKO.1 1069 CDS 100% 4.050 3.240 N Chka n/a
5 TRCN0000361030 AGTGCTGACTTAGGATATTAA pLKO_005 1953 3UTR 100% 15.000 10.500 N Chka n/a
6 TRCN0000378406 AGGCCGACTGGAGCAGTTTAT pLKO_005 843 CDS 100% 13.200 9.240 N Chka n/a
7 TRCN0000024608 GAATTTGGGTACATGGAATAT pLKO.1 1537 CDS 100% 13.200 9.240 N Chka n/a
8 TRCN0000024607 GAGTTACGTTTACCAGATATT pLKO.1 889 CDS 100% 13.200 9.240 N Chka n/a
9 TRCN0000378430 GGCGGAAGCTGATGCTTATTG pLKO_005 1205 CDS 100% 13.200 9.240 N Chka n/a
10 TRCN0000234180 ATACCTGAATCAAGTACTAAG pLKO_005 1002 CDS 100% 10.800 7.560 N Chka n/a
11 TRCN0000234182 ATAGCTCAGAACCCGCCTAAA pLKO_005 1849 3UTR 100% 10.800 7.560 N Chka n/a
12 TRCN0000024604 GCCATTCAATAAGGAACCAAA pLKO.1 957 CDS 100% 4.950 3.465 N Chka n/a
13 TRCN0000218179 GAGTACAGCAGTTACAATTAC pLKO_005 1231 CDS 100% 13.200 7.920 N Chka n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013490.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14583 pDONR223 100% 64.1% 17.1% None (many diffs) n/a
2 ccsbBroad304_14583 pLX_304 0% 64.1% 17.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468458 GCTCCATCGTAGTTTCAGGTTTAT pLX_317 33% 64.1% 17.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15336 pDONR223 100% 62% 61.6% None (many diffs) n/a
5 ccsbBroad304_15336 pLX_304 0% 62% 61.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV