Transcript: Mouse NM_175234.4

Mus musculus failed axon connections homolog (Faxc), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Faxc (76132)
Length:
9342
CDS:
239..1468

Additional Resources:

NCBI RefSeq record:
NM_175234.4
NBCI Gene record:
Faxc (76132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175234.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193397 CAGTTTGCAAGACCTAACAAT pLKO.1 548 CDS 100% 5.625 7.875 N Faxc n/a
2 TRCN0000193343 CCTACCCTATCAGAACTATTT pLKO.1 628 CDS 100% 13.200 9.240 N Faxc n/a
3 TRCN0000176108 GACCTACCCTATCAGAACTAT pLKO.1 626 CDS 100% 5.625 3.938 N Faxc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175234.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09201 pDONR223 100% 93.4% 98.5% None (many diffs) n/a
2 ccsbBroad304_09201 pLX_304 0% 93.4% 98.5% V5 (many diffs) n/a
3 TRCN0000468524 AGGACATTGAAATAATTGTCCCCC pLX_317 38.1% 93.4% 98.5% V5 (many diffs) n/a
4 ccsbBroadEn_12830 pDONR223 100% 28.6% 31% None (many diffs) n/a
5 ccsbBroad304_12830 pLX_304 0% 28.6% 31% V5 (many diffs) n/a
6 TRCN0000469512 CTCAGTCAGACTCGTTTTTATGGG pLX_317 81.5% 28.6% 31% V5 (many diffs) n/a
Download CSV