Transcript: Human NR_144463.2

Homo sapiens failed axon connections homolog, metaxin like GST domain containing (FAXC), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
FAXC (84553)
Length:
10899
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144463.2
NBCI Gene record:
FAXC (84553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145210 GACTTACCGTATCAGAACTAT pLKO.1 285 3UTR 100% 5.625 7.875 N FAXC n/a
2 TRCN0000141386 CCACGATGATGACAATACCAT pLKO.1 678 3UTR 100% 3.000 4.200 N FAXC n/a
3 TRCN0000193397 CAGTTTGCAAGACCTAACAAT pLKO.1 207 3UTR 100% 5.625 3.938 N Faxc n/a
4 TRCN0000145447 GCAAGAGATTGACTCTAAAGA pLKO.1 170 3UTR 100% 5.625 3.938 N FAXC n/a
5 TRCN0000140243 GCTGGTTGTCAGCTGATAGTT pLKO.1 1198 3UTR 100% 5.625 3.938 N FAXC n/a
6 TRCN0000144119 CGATGATGACAATACCATCTA pLKO.1 681 3UTR 100% 4.950 3.465 N FAXC n/a
7 TRCN0000142017 GCATGGTTCCTGAAATCCATT pLKO.1 1123 3UTR 100% 4.950 3.465 N FAXC n/a
8 TRCN0000140766 GATTCGGATGTGGACATGGAT pLKO.1 853 3UTR 100% 3.000 2.100 N FAXC n/a
9 TRCN0000142110 GATGACTATACAGACCACGAA pLKO.1 871 3UTR 100% 2.640 1.848 N FAXC n/a
10 TRCN0000142199 GATGGATTCTTGAACCTCCTT pLKO.1 1259 3UTR 100% 2.640 1.848 N FAXC n/a
11 TRCN0000180546 GCCTGTAATCCCAGGACTTTA pLKO.1 9613 3UTR 100% 13.200 6.600 Y PRR11 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 9877 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 9778 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09201 pDONR223 100% 7.9% None (many diffs) n/a
2 ccsbBroad304_09201 pLX_304 0% 7.9% V5 (many diffs) n/a
3 TRCN0000468524 AGGACATTGAAATAATTGTCCCCC pLX_317 38.1% 7.9% V5 (many diffs) n/a
4 ccsbBroadEn_12830 pDONR223 100% 3.5% None 1_513del;901_10899del n/a
5 ccsbBroad304_12830 pLX_304 0% 3.5% V5 1_513del;901_10899del n/a
6 TRCN0000469512 CTCAGTCAGACTCGTTTTTATGGG pLX_317 81.5% 3.5% V5 1_513del;901_10899del n/a
Download CSV