Construct: ORF TRCN0000468552
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016308.1_s317c1
- Derived from:
- ccsbBroadEn_16020
- DNA Barcode:
- TTAACTTTATTTAAAGCCTACTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RASSF5 (83593)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468552
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 83593 | RASSF5 | Ras association domain fami... | NM_182665.4 | 100% | 100% | |
| 2 | human | 83593 | RASSF5 | Ras association domain fami... | NM_182663.4 | 57.4% | 54.1% | (many diffs) |
| 3 | human | 83593 | RASSF5 | Ras association domain fami... | NM_182664.4 | 38.3% | 33.7% | (many diffs) |
| 4 | mouse | 54354 | Rassf5 | Ras association (RalGDS/AF-... | NM_001311094.2 | 89.3% | 94.7% | (many diffs) |
| 5 | mouse | 54354 | Rassf5 | Ras association (RalGDS/AF-... | NM_018750.4 | 53.8% | 51.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 861
- ORF length:
- 795
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac cgtggacagc agcatgagca gtgggtactg cagcctggac gaggaactgg 121 aagactgctt cttcactgct aagactacct ttttcagaaa tgcgcagagc aaacatcttt 181 caaagaatgt ctgtaaacct gtggaggaga cacagcgccc gcccacactg caggagatca 241 agcagaagat cgacagctac aacacgcgag agaagaactg cctgggcatg aaactgagtg 301 aagacggcac ctacacgggt ttcatcaaag tgcatctgaa actccggcgg cctgtgacgg 361 tgcctgctgg gatccggccc cagtccatct atgatgccat caaggaggtg aacctggcgg 421 ctaccacgga caagcggaca TCCTTCTACC TGCCCCTAGA TGCCATCAAG CAGCTGCACA 481 TCAGCAGCAC CACCACCGTC AGTGAGGTCA TCCAGGGGCT GCTCAAGAAG TTCATGGTTG 541 TGGACAATCC CCAGAAGTTT GCACTTTTTA AGCGGATACA CAAGGACGGA CAAGTGCTCT 601 TCCAGAAACT CTCCATTGCT GACCGCCCCC TCTACCTGCG CCTGCTTGCT GGGCCTGACA 661 CGGAGGTCCT CAGCTTTGTG CTAAAGGAGA ATGAAACTGG AGAGGTAGAG TGGGATGCCT 721 TCTCCATCCC TGAACTTCAG AACTTCCTAA CAATCCTGGA AAAAGAGGAG CAGGACAAAA 781 TCCAACAAGT GCAAAAGAAG TATGACAAGT TTAGGCAGAA ACTGGAGGAG GCCTTAAGAG 841 AATCCCAGGG CAAACCTGGG TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 901 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 961 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATTAA CTTTATTTAA 1021 AGCCTACTAA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt