Transcript: Mouse NM_001311094.2

Mus musculus Ras association (RalGDS/AF-6) domain family member 5 (Rassf5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rassf5 (54354)
Length:
3131
CDS:
214..1011

Additional Resources:

NCBI RefSeq record:
NM_001311094.2
NBCI Gene record:
Rassf5 (54354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419744 AGGATCAAATGTGGCATATTC pLKO_005 1444 3UTR 100% 13.200 9.240 N Rassf5 n/a
2 TRCN0000421562 AGGTTTCATCAAAGTGCATTT pLKO_005 465 CDS 100% 10.800 7.560 N Rassf5 n/a
3 TRCN0000077716 GACACCGATGTTCTCAGCTTT pLKO.1 805 CDS 100% 4.950 3.465 N Rassf5 n/a
4 TRCN0000077717 GAGCAGGACAAGATCCATCAA pLKO.1 916 CDS 100% 4.950 3.465 N Rassf5 n/a
5 TRCN0000077715 GATGCCATCAAGCAGCTACAT pLKO.1 607 CDS 100% 4.950 3.465 N Rassf5 n/a
6 TRCN0000077714 CGGATACACAAAGATGGACAA pLKO.1 721 CDS 100% 4.050 2.835 N Rassf5 n/a
7 TRCN0000002082 GAGAATGAAACTGGAGAGGTA pLKO.1 835 CDS 100% 2.640 1.848 N RASSF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16020 pDONR223 0% 89.3% 94.7% None (many diffs) n/a
2 ccsbBroad304_16020 pLX_304 0% 89.3% 94.7% V5 (many diffs) n/a
3 TRCN0000468552 TTAACTTTATTTAAAGCCTACTAA pLX_317 52.8% 89.3% 94.7% V5 (many diffs) n/a
Download CSV