Transcript: Mouse NM_018750.4

Mus musculus Ras association (RalGDS/AF-6) domain family member 5 (Rassf5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rassf5 (54354)
Length:
3410
CDS:
49..1290

Additional Resources:

NCBI RefSeq record:
NM_018750.4
NBCI Gene record:
Rassf5 (54354)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018750.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077713 GCGCTGCGCTAATTGTAAATT pLKO.1 480 CDS 100% 15.000 12.000 N Rassf5 n/a
2 TRCN0000419744 AGGATCAAATGTGGCATATTC pLKO_005 1723 3UTR 100% 13.200 9.240 N Rassf5 n/a
3 TRCN0000421562 AGGTTTCATCAAAGTGCATTT pLKO_005 744 CDS 100% 10.800 7.560 N Rassf5 n/a
4 TRCN0000077716 GACACCGATGTTCTCAGCTTT pLKO.1 1084 CDS 100% 4.950 3.465 N Rassf5 n/a
5 TRCN0000077717 GAGCAGGACAAGATCCATCAA pLKO.1 1195 CDS 100% 4.950 3.465 N Rassf5 n/a
6 TRCN0000077715 GATGCCATCAAGCAGCTACAT pLKO.1 886 CDS 100% 4.950 3.465 N Rassf5 n/a
7 TRCN0000077714 CGGATACACAAAGATGGACAA pLKO.1 1000 CDS 100% 4.050 2.835 N Rassf5 n/a
8 TRCN0000002082 GAGAATGAAACTGGAGAGGTA pLKO.1 1114 CDS 100% 2.640 1.848 N RASSF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018750.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16020 pDONR223 0% 53.8% 51.7% None (many diffs) n/a
2 ccsbBroad304_16020 pLX_304 0% 53.8% 51.7% V5 (many diffs) n/a
3 TRCN0000468552 TTAACTTTATTTAAAGCCTACTAA pLX_317 52.8% 53.8% 51.7% V5 (many diffs) n/a
Download CSV