Transcript: Human NM_182663.4

Homo sapiens Ras association domain family member 5 (RASSF5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RASSF5 (83593)
Length:
3799
CDS:
73..1329

Additional Resources:

NCBI RefSeq record:
NM_182663.4
NBCI Gene record:
RASSF5 (83593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182663.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230732 CCTACACGGGTTTCATCAAAG pLKO_005 776 CDS 100% 10.800 15.120 N RASSF5 n/a
2 TRCN0000002086 GCCACGTACAGGACCATTATT pLKO.1 1733 3UTR 100% 15.000 12.000 N RASSF5 n/a
3 TRCN0000230734 GCCACGTACAGGACCATTATT pLKO_005 1733 3UTR 100% 15.000 12.000 N RASSF5 n/a
4 TRCN0000230733 GTCCTCAGCTTTGTGCTAAAG pLKO_005 1132 CDS 100% 10.800 8.640 N RASSF5 n/a
5 TRCN0000002083 GCGCTGCACTAACTGTAAATT pLKO.1 519 CDS 100% 15.000 10.500 N RASSF5 n/a
6 TRCN0000230731 CAGTCAGCAGGAGGGTTTATC pLKO_005 582 CDS 100% 13.200 9.240 N RASSF5 n/a
7 TRCN0000002085 CTGGGCATGAAACTGAGTGAA pLKO.1 748 CDS 100% 4.950 3.465 N RASSF5 n/a
8 TRCN0000002084 GCAGAAGATCGACAGCTACAA pLKO.1 708 CDS 100% 4.950 3.465 N RASSF5 n/a
9 TRCN0000218031 CTTCAGAACTTCCTAACAATC pLKO_005 1201 CDS 100% 10.800 6.480 N RASSF5 n/a
10 TRCN0000002082 GAGAATGAAACTGGAGAGGTA pLKO.1 1153 CDS 100% 2.640 1.584 N RASSF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182663.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16020 pDONR223 0% 57.4% 54.1% None (many diffs) n/a
2 ccsbBroad304_16020 pLX_304 0% 57.4% 54.1% V5 (many diffs) n/a
3 TRCN0000468552 TTAACTTTATTTAAAGCCTACTAA pLX_317 52.8% 57.4% 54.1% V5 (many diffs) n/a
Download CSV