Construct: ORF TRCN0000468978
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018466.1_s317c1
- Derived from:
- ccsbBroadEn_03755
- DNA Barcode:
- GTAACTTCACCTCATTCCCCCTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IFT46 (56912)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468978
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56912 | IFT46 | intraflagellar transport 46 | NM_001168618.1 | 100% | 100% | |
| 2 | human | 56912 | IFT46 | intraflagellar transport 46 | XM_011542906.3 | 100% | 100% | |
| 3 | human | 56912 | IFT46 | intraflagellar transport 46 | XM_017018018.2 | 100% | 100% | |
| 4 | human | 56912 | IFT46 | intraflagellar transport 46 | NM_020153.3 | 85.6% | 85.6% | 43_195del |
| 5 | human | 56912 | IFT46 | intraflagellar transport 46 | XM_011542905.3 | 85.6% | 85.6% | 43_195del |
| 6 | human | 56912 | IFT46 | intraflagellar transport 46 | XM_017018017.1 | 85.6% | 85.6% | 43_195del |
| 7 | mouse | 76568 | Ift46 | intraflagellar transport 46 | NM_023831.3 | 85.9% | 94% | (many diffs) |
| 8 | mouse | 76568 | Ift46 | intraflagellar transport 46 | XM_006510671.3 | 85.9% | 94% | (many diffs) |
| 9 | mouse | 76568 | Ift46 | intraflagellar transport 46 | XM_006510672.3 | 63.8% | 70.3% | (many diffs) |
| 10 | mouse | 76568 | Ift46 | intraflagellar transport 46 | XR_001779069.1 | 45.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 978
- ORF length:
- 912
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgataacagc agtgatgagt gtgaagagga aaataacaag gagaagaaga 121 agacctcaca gttgacacct caacggggct ttagtgaaaa tgaggatgac gatgatgatg 181 atgatgattc atctgaaact gattctgatt ctgatgatga tgatgaagag catggagccc 241 ctctggaagg ggcctatgac cctgcagact atgagcattt gccagtttct gctgaaatta 301 aggaactctt ccagtacatc agtaggtaca cacctcagtt gattgacctg gaccacaaac 361 tgaagccttt cattcctgat tttatcccag ctgtcgggga tattgatgca ttcttaaagg 421 tcccacgtcc tgatggaaag cctgacaacc ttggcctatt ggtattggat gaaccttcta 481 caaagcagtc agaccctacg gtgctctcac tctggttaac agagaattct aagcagcaca 541 acatcacaca acatatgaaa gtaaaaagcc tagaagatgc agaaaagaaT CCCAAAGCCA 601 TTGACACGTG GATTGAGAGC ATCTCTGAAT TACACCGTTC TAAGCCCCCT GCGACTGTGC 661 ACTACACCAG GCCCATGCCC GACATTGACA CGCTGATGCA GGAATGGTCC CCGGAGTTTG 721 AAGAGCTTTT GGGCAAGGTA AGCCTGCCCA CGGCAGAGAT TGATTGCAGC CTGGCAGAGT 781 ACATTGACAT GATCTGTGCC ATTCTAGACA TCCCTGTCTA CAAGAGTCGG ATCCAGTCCC 841 TCCATCTGCT CTTTTCCCTC TACTCAGAAT TCAAGAACTC ACAGCATTTT AAAGCTCTCG 901 CTGAAGGCAA GAAAGCATTC ACTCCTTCAT CCAATTCCAC CTCCCAAGCT GGAGACATGG 961 AGACATTAAC CTTCAGCTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1021 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1081 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGTAACTT CACCTCATTC 1141 CCCCTCTACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt