Transcript: Human XM_011542905.3

PREDICTED: Homo sapiens intraflagellar transport 46 (IFT46), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IFT46 (56912)
Length:
5439
CDS:
3994..5061

Additional Resources:

NCBI RefSeq record:
XM_011542905.3
NBCI Gene record:
IFT46 (56912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542905.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074374 CCACAAACTGAAGCCTTTCAT pLKO.1 4434 CDS 100% 5.625 7.875 N IFT46 n/a
2 TRCN0000074375 GCATCTCTGAATTACACCGTT pLKO.1 4700 CDS 100% 2.640 3.696 N IFT46 n/a
3 TRCN0000074376 TCTCTGAATTACACCGTTCTA pLKO.1 4703 CDS 100% 4.950 3.960 N IFT46 n/a
4 TRCN0000419523 CTATGAGCATTTGCCAGTTTC pLKO_005 4350 CDS 100% 10.800 7.560 N IFT46 n/a
5 TRCN0000415617 TGATTCATCTGAAACTGATTC pLKO_005 4266 CDS 100% 10.800 7.560 N IFT46 n/a
6 TRCN0000074377 CCTGGCAGAGTACATTGACAT pLKO.1 4851 CDS 100% 4.950 3.465 N IFT46 n/a
7 TRCN0000074373 GCACAGAACATGTTTGTTTAA pLKO.1 5210 3UTR 100% 13.200 7.920 N IFT46 n/a
8 TRCN0000424215 CATTCACTCCTTCATCCAATT pLKO_005 4997 CDS 100% 10.800 6.480 N IFT46 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1021 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542905.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03755 pDONR223 100% 85.6% 85.6% None 43_195del n/a
2 ccsbBroad304_03755 pLX_304 0% 85.6% 85.6% V5 43_195del n/a
3 TRCN0000468978 GTAACTTCACCTCATTCCCCCTCT pLX_317 42.8% 85.6% 85.6% V5 43_195del n/a
Download CSV