Construct: ORF TRCN0000468996
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016932.1_s317c1
- Derived from:
- ccsbBroadEn_15905
- DNA Barcode:
- CTAATGCTTATACTGTCAATCCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KIF16B (55614)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468996
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55614 | KIF16B | kinesin family member 16B | NM_001199865.2 | 13.6% | 13.5% | (many diffs) |
2 | human | 55614 | KIF16B | kinesin family member 16B | XM_005260755.3 | 13.5% | 13.3% | (many diffs) |
3 | human | 55614 | KIF16B | kinesin family member 16B | XM_005260754.3 | 13.4% | 13.4% | 1_3372del |
4 | human | 55614 | KIF16B | kinesin family member 16B | NM_024704.5 | 13.2% | 13.2% | 1_3339del;3620_3709del |
5 | human | 55614 | KIF16B | kinesin family member 16B | XM_005260753.3 | 13.1% | 13.1% | 1_3372del;3653_3742del |
6 | human | 55614 | KIF16B | kinesin family member 16B | XM_017027926.1 | 11.7% | 10.7% | (many diffs) |
7 | human | 55614 | KIF16B | kinesin family member 16B | XM_006723588.3 | 11.6% | 10.6% | (many diffs) |
8 | mouse | 16558 | Kif16b | kinesin family member 16B | XM_006498819.3 | 11.6% | 12.1% | (many diffs) |
9 | mouse | 16558 | Kif16b | kinesin family member 16B | NM_001081133.2 | 11.2% | 11.6% | (many diffs) |
10 | mouse | 16558 | Kif16b | kinesin family member 16B | XM_006498817.3 | 11.1% | 11.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 588
- ORF length:
- 522
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tgccaggatc aatgcttaca ttgaagaaga agtccaaaga cgccttcagg 121 atttgcatcg tgtgattagt gaaggctgca gtacatctgc agacacgatg aaggataatg 181 agaaacttca caatggcacc attcaacgta aactaaaata tgagcggatg gtttctcgct 241 ctttgggcgc aaatccagat gacctgaagg acccaattaa aattagtatc ccacgctacg 301 tcctctgcgg gcaaggaaag gatgcacact tcgagtttga ggtcaagctt gctgcccttg 361 aatttcctcc aaagaaacta tttggaaata aggatgaacg tgtgattgct gagagacgaa 421 gtcacttaga gaaatacctc agGGACTTTT TCAGCGTGAT GCTCCAGTCC GCAACATCTC 481 CCCTCCACAT CAACAAAGTG GGACTGACTC TCTCGAAACA TACCATTTGT GAGTTTTCAC 541 CATTCTTCAA GAAAGGAGTC TTTGACTACA GCAGCCACGG GACGGGGTAC CCAACTTTCT 601 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 661 CGTAGTAATG AACTAGCCCG TAACTTGAAA GTTTTCGATT TCTTGGCTTT ATATATCTTG 721 TGGAAAGGAC GACTAATGCT TATACTGTCA ATCCCCACGC GTTAAGTCga caatcaacct 781 ctggattaca aaatttgtga aagatt