Transcript: Human NM_001199865.2

Homo sapiens kinesin family member 16B (KIF16B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
KIF16B (55614)
Length:
5123
CDS:
174..3974

Additional Resources:

NCBI RefSeq record:
NM_001199865.2
NBCI Gene record:
KIF16B (55614)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074492 CGCTATGCAAATAGAGCCAAA pLKO.1 1221 CDS 100% 4.050 5.670 N KIF16B n/a
2 TRCN0000074489 GCCCTTATGTTGAGGATTTAT pLKO.1 715 CDS 100% 15.000 12.000 N KIF16B n/a
3 TRCN0000289536 GCCCTTATGTTGAGGATTTAT pLKO_005 715 CDS 100% 15.000 12.000 N KIF16B n/a
4 TRCN0000252035 ATCAACAAGCCTACCATTAAT pLKO_005 1248 CDS 100% 15.000 10.500 N Kif16b n/a
5 TRCN0000074488 CCTCATTTGAATCAGAACTTT pLKO.1 4485 3UTR 100% 5.625 3.938 N KIF16B n/a
6 TRCN0000289597 CCTCATTTGAATCAGAACTTT pLKO_005 4485 3UTR 100% 5.625 3.938 N KIF16B n/a
7 TRCN0000074490 GCACCATTCAACGTAAACTAA pLKO.1 3490 CDS 100% 5.625 3.938 N KIF16B n/a
8 TRCN0000289596 GCACCATTCAACGTAAACTAA pLKO_005 3490 CDS 100% 5.625 3.938 N KIF16B n/a
9 TRCN0000074491 GCCATGTGAAACCGTCAGTAA pLKO.1 893 CDS 100% 4.950 3.465 N KIF16B n/a
10 TRCN0000289595 GCCATGTGAAACCGTCAGTAA pLKO_005 893 CDS 100% 4.950 3.465 N KIF16B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12234 pDONR223 100% 52.5% 52.5% None 1996_3798del n/a
2 ccsbBroad304_12234 pLX_304 0% 52.5% 52.5% V5 1996_3798del n/a
3 TRCN0000468768 ACGACCCCGTTCCCTTAATACACA pLX_317 20.4% 52.5% 52.5% V5 1996_3798del n/a
4 ccsbBroadEn_15905 pDONR223 0% 13.6% 13.5% None (many diffs) n/a
5 ccsbBroad304_15905 pLX_304 0% 13.6% 13.5% V5 (many diffs) n/a
6 TRCN0000468996 CTAATGCTTATACTGTCAATCCCC pLX_317 28.7% 13.6% 13.5% V5 (many diffs) n/a
Download CSV