Transcript: Human XM_005260755.3

PREDICTED: Homo sapiens kinesin family member 16B (KIF16B), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF16B (55614)
Length:
5165
CDS:
183..4016

Additional Resources:

NCBI RefSeq record:
XM_005260755.3
NBCI Gene record:
KIF16B (55614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074492 CGCTATGCAAATAGAGCCAAA pLKO.1 1230 CDS 100% 4.050 5.670 N KIF16B n/a
2 TRCN0000074489 GCCCTTATGTTGAGGATTTAT pLKO.1 724 CDS 100% 15.000 12.000 N KIF16B n/a
3 TRCN0000289536 GCCCTTATGTTGAGGATTTAT pLKO_005 724 CDS 100% 15.000 12.000 N KIF16B n/a
4 TRCN0000252035 ATCAACAAGCCTACCATTAAT pLKO_005 1257 CDS 100% 15.000 10.500 N Kif16b n/a
5 TRCN0000074488 CCTCATTTGAATCAGAACTTT pLKO.1 4527 3UTR 100% 5.625 3.938 N KIF16B n/a
6 TRCN0000289597 CCTCATTTGAATCAGAACTTT pLKO_005 4527 3UTR 100% 5.625 3.938 N KIF16B n/a
7 TRCN0000074490 GCACCATTCAACGTAAACTAA pLKO.1 3532 CDS 100% 5.625 3.938 N KIF16B n/a
8 TRCN0000289596 GCACCATTCAACGTAAACTAA pLKO_005 3532 CDS 100% 5.625 3.938 N KIF16B n/a
9 TRCN0000074491 GCCATGTGAAACCGTCAGTAA pLKO.1 902 CDS 100% 4.950 3.465 N KIF16B n/a
10 TRCN0000289595 GCCATGTGAAACCGTCAGTAA pLKO_005 902 CDS 100% 4.950 3.465 N KIF16B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12234 pDONR223 100% 52% 52% None 1784_1816del;2029_3831del n/a
2 ccsbBroad304_12234 pLX_304 0% 52% 52% V5 1784_1816del;2029_3831del n/a
3 TRCN0000468768 ACGACCCCGTTCCCTTAATACACA pLX_317 20.4% 52% 52% V5 1784_1816del;2029_3831del n/a
4 ccsbBroadEn_15905 pDONR223 0% 13.5% 13.3% None (many diffs) n/a
5 ccsbBroad304_15905 pLX_304 0% 13.5% 13.3% V5 (many diffs) n/a
6 TRCN0000468996 CTAATGCTTATACTGTCAATCCCC pLX_317 28.7% 13.5% 13.3% V5 (many diffs) n/a
Download CSV