Construct: ORF TRCN0000469039
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012138.1_s317c1
- Derived from:
- ccsbBroadEn_01728
- DNA Barcode:
- GCTGTTCGAGCGCCCTACAACCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TULP2 (7288)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469039
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7288 | TULP2 | TUB like protein 2 | NM_003323.3 | 100% | 100% | |
| 2 | human | 7288 | TULP2 | TUB like protein 2 | XM_006723347.3 | 97.9% | 97.7% | 1448_1480del |
| 3 | human | 7288 | TULP2 | TUB like protein 2 | XM_006723348.3 | 97.9% | 97.7% | 1448_1480del |
| 4 | human | 7288 | TULP2 | TUB like protein 2 | XM_011527252.3 | 97.9% | 97.7% | 1448_1480del |
| 5 | human | 7288 | TULP2 | TUB like protein 2 | XM_011527253.2 | 97.3% | 97.1% | 200_201insAGGTGACAG;1439_1471del |
| 6 | human | 7288 | TULP2 | TUB like protein 2 | XM_024451682.1 | 95.7% | 95.7% | 0_1ins57;143_144insAGGTGACAG |
| 7 | human | 7288 | TULP2 | TUB like protein 2 | XM_011527254.2 | 91.7% | 91.5% | 1174_1175ins99;1349_1381del |
| 8 | human | 7288 | TULP2 | TUB like protein 2 | XM_024451683.1 | 90% | 90% | 0_1ins57;1117_1118ins99 |
| 9 | human | 7288 | TULP2 | TUB like protein 2 | XM_011527255.2 | 89.6% | 89.4% | 0_1ins132;1316_1348del |
| 10 | human | 7288 | TULP2 | TUB like protein 2 | XM_011527256.2 | 89.6% | 89.4% | 0_1ins132;1316_1348del |
| 11 | human | 7288 | TULP2 | TUB like protein 2 | XR_935852.2 | 70.5% | 1_151del;1212_1213ins214;1498_1694del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1626
- ORF length:
- 1560
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tcaggataat gacacattga tgagagacat cctggggcat gagctcgctg 121 ctatgaggct gcagaagctg gaacagcagc ggcggctgtt tgaaaagaag cagcgacaga 181 agcgccagga gctcctcatg gttcaggcca atcctgacgc ttccccgtgg ctttggcgct 241 cttgtctgcg ggaggagcgc cttttaggtg acagaggcct tgggaaccct ttcctccgga 301 agaaagtgtc agaggcacat ctgccctctg gcatccacag tgccctgggc accgtgagct 361 gtggtggaga cggcaggggc gagcgcggcc tcccgacacc gcggacagaa gcagtgttca 421 ggaatctcgg tctccagtcc cctttcttat cctggctccc agacaattcc gatgcagaat 481 tggaggaagt ctccgtggag aatggttccg tctctccccc accttttaaa cagtctccga 541 gaatccgacg caagggttgg caagcccacc aacgacctgg gacccgtgca gagggtgaga 601 gtgactccca ggatatggga gatgcacaca agtcacccaa tatgggacca aaccctggaa 661 tggatggtga ctgtgtatat gaaaacttgg ccttccaaaa ggaagaagac ttggaaaaga 721 agagagaggc ctctgagtct acagggacga actcctcagc agcacacaac gaagagttgt 781 ccaaggccct gaaaggcgag ggtggcacgg acagcgacca tatgaggcac gaagcctcct 841 tggcaatccg ctccccctgc cctgggctgg aggaggacat ggaagcctac gtgctgcggc 901 cagcgctccc gggcaccatg atgcagtgct acctcacccg tgacaagcac ggcgtggaca 961 agggcttgtt ccccctctac tacctctacc tggagacctc tgacagcctg cagcgcttcc 1021 tcctggctgg gcgaaagaga agaaggagca aaacttctaa ttacctcatc tccctggatc 1081 ctacacacct atctcgggac ggggacaatt tcgtgggcaa agtcagatcc aatgtcttca 1141 gcaccaagtt caccatcttt gacaatgggg tgaatcctga ccgggagcat ttaaccagga 1201 atactgcccg gaTCAGACAG GAGCTGGGGG CTGTGTGTTA TGAGCCCAAC GTCTTAGGAT 1261 ACCTGGGGCC TCGGAAAATG ACTGTGATTC TCCCAGGAAC CAACAGCCAG AACCAGCGAA 1321 TCAATGTCCA GCCACTAAAT GAACAGGAGT CGCTACTGAG TCGTTACCAA CGTGGGGACA 1381 AACAAGGGTT GCTTTTGTTG CACAACAAAA CCCCGTCGTG GGACAAGGAG AACGGTGTCT 1441 ACACGCTCAA TTTCCATGGT CGAGTCACTC GGGCTTCGGT GAAGAACTTC CAAATCGTGG 1501 ATCCCAAACA CCAAGAACAT CTGGTGCTCC AGTTCGGCCG AGTGGGCCCA GACACATTCA 1561 CCATGGACTT CTGCTTTCCA TTTAGCCCGC TCCAGGCCTT CAGCATCTGC TTGTCCAGTT 1621 TCAATTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1681 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1741 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGCTGTTCGA GCGCCCTACA ACCATACGCG 1801 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt