Construct: ORF TRCN0000469091
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002571.1_s317c1
- Derived from:
- ccsbBroadEn_02947
- DNA Barcode:
- CTCCCCTACCCATATACACTCTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXO4 (26272)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469091
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26272 | FBXO4 | F-box protein 4 | NM_012176.3 | 100% | 100% | |
| 2 | human | 26272 | FBXO4 | F-box protein 4 | XM_011514026.3 | 83% | 76.3% | (many diffs) |
| 3 | human | 26272 | FBXO4 | F-box protein 4 | NM_033484.2 | 78.9% | 77.5% | (many diffs) |
| 4 | human | 26272 | FBXO4 | F-box protein 4 | NM_001297437.1 | 78.4% | 77.2% | (many diffs) |
| 5 | human | 26272 | FBXO4 | F-box protein 4 | XM_011514027.2 | 64.6% | 62.7% | (many diffs) |
| 6 | human | 26272 | FBXO4 | F-box protein 4 | XM_006714470.4 | 62.7% | 62.7% | 0_1ins432 |
| 7 | mouse | 106052 | Fbxo4 | F-box protein 4 | NM_134099.2 | 85% | 88.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1227
- ORF length:
- 1161
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gggaagcgag ccgcgcagcg gaacaaactc gccgccgccg cccttcagcg 121 actggggccg cctggaggcg gccatcctca gcggctggaa gaccttctgg cagtcagtga 181 gcaaggagag ggtggcgcgt acgacctcac gggaggaggt ggatgaggcg gccagcaccc 241 tgacgcggct gccgattgat gtacagctat atattttgtc ctttctttca cctcatgatc 301 tgtgtcagtt gggaagtaca aatcattatt ggaatgaaac tgtaagagat ccaattctgt 361 ggagatactt tttgttgagg gatcttcctt cttggtcttc tgttgactgg aagtctcttc 421 cagatctaga aatcttaaaa aagcctatat ctgaggtcac tgatggtgca ttttttgact 481 acatggcagt ctatagaatg tgctgtccat acacaagaag agcttcaaaa tccagccgtc 541 ctatgtatgg agctgtcact tcttttttac actccctgat cattcagaat gaaccacgat 601 ttgctatgtt tggaccaggt ttggaagaat tgaatacctc tttggtgttg agcttgatgt 661 cttcagagga actttgccca acagctggtt tgcctcagag gcagattgat ggtattggat 721 caggagtcaa ttttcagttg aaCAACCAAC ATAAATTCAA CATTCTAATC TTATATTCAA 781 CTACCAGAAA GGAAAGAGAT AGAGCAAGGG AAGAGCATAC AAGTGCAGTT AACAAGATGT 841 TCAGTCGACA CAATGAAGGT GATGATCAAC AAGGAAGCCG GTACAGTGTG ATTCCACAGA 901 TTCAAAAAGT GTGTGAAGTT GTAGATGGGT TCATCTATGT TGCAAATGCT GAAGCTCATA 961 AAAGACATGA ATGGCAAGAT GAATTTTCTC ATATTATGGC AATGACAGAT CCAGCCTTTG 1021 GGTCTTCGGG AAGACCATTG TTGGTTTTAT CTTGTATTTC TCAAGGGGAT GTAAAAAGAA 1081 TGCCCTGTTT TTATTTGGCT CATGAGCTGC ATCTGAATCT TCTAAATCAC CCATGGCTGG 1141 TCCAGGATAC AGAGGCTGAA ACTCTGACTG GTTTTTTGAA TGGCATTGAG TGGATTCTTG 1201 AAGAAGTGGA ATCTAAGCGT GCAAGATGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACTCCCCTA 1381 CCCATATACA CTCTTTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1441 aagatt