Transcript: Human XM_011514026.3

PREDICTED: Homo sapiens F-box protein 4 (FBXO4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXO4 (26272)
Length:
8462
CDS:
7250..8275

Additional Resources:

NCBI RefSeq record:
XM_011514026.3
NBCI Gene record:
FBXO4 (26272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034322 CGATTGATGTACAGCTATATA pLKO.1 7437 CDS 100% 15.000 21.000 N FBXO4 n/a
2 TRCN0000034323 CCTATATCTGAGGTCACTGAT pLKO.1 7628 CDS 100% 4.950 6.930 N FBXO4 n/a
3 TRCN0000420271 CAGTTGAACAACCAACATAAA pLKO_005 7919 CDS 100% 13.200 9.240 N FBXO4 n/a
4 TRCN0000433092 GTATTGGATCAGGAGTCAATT pLKO_005 7896 CDS 100% 13.200 9.240 N FBXO4 n/a
5 TRCN0000034319 CCAGGTTTGGAAGAATTGAAT pLKO.1 7799 CDS 100% 5.625 3.375 N FBXO4 n/a
6 TRCN0000135166 CCCACACAGTTGGAGAATAAT pLKO.1 2181 5UTR 100% 15.000 7.500 Y C5orf51 n/a
7 TRCN0000135852 CCTCAGCTTTATGGGATACTA pLKO.1 393 5UTR 100% 5.625 2.813 Y C5orf51 n/a
8 TRCN0000138149 GCTCCTTTGTTCTGGTCCTTT pLKO.1 1739 5UTR 100% 4.950 2.475 Y C5orf51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02947 pDONR223 100% 83% 76.3% None (many diffs) n/a
2 ccsbBroad304_02947 pLX_304 0% 83% 76.3% V5 (many diffs) n/a
3 TRCN0000469091 CTCCCCTACCCATATACACTCTTT pLX_317 41.9% 83% 76.3% V5 (many diffs) n/a
Download CSV